Your Trusted Grapevine Testing Resource
Agri-Analysis LLC is an independent agricultural diagnostic laboratory which provides clients with access to state-of-the-art laboratory techniques and procedures to answer their agricultural production problems. We employ enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), as well as traditional culturing and numeration methods to detect and identify specific viral, bacterial and fungal pathogens in plant material, seed and soil. Our customers include growers, management companies, growers associations, agricultural consultants, universities, research institutes, service laboratories, seed companies, real estate agents, and property owners, etc.
Agri-Analysis was founded in 1981 by plant pathologist Glenn Friebertshauser, who desired to establish his own laboratory to diagnose plant diseases after completing his studies in University of California, Davis. His interest spanned fungal, viral and bacterial pathogens of plants, vines, trees and soil. His initial service to the agricultural community was in the development of a commercially applicable assay for lettuce mosaic virus (LMV), allowing for screening of virus-free lettuce seed lots before planting. In the mid-80's he became interested in diseases of grapevines and saw the need in the industry for laboratory assays to diagnose the presence of viral pathogens such as fanleaf virus, leafroll associated viruses and corky bark virus. Later, he developed additional assays for the bacterium Xylella fastidiosa (causal agent for Pierce's Disease in grapes and almond leaf scorch) and fungal diseases, notably those associated with Esca, also known as young vine decline.
OUR MISSION
As the world is faced with increasing risks and challenges from economically important plant diseases, Agri-Analysis is your trusted laboratory partner in identifying, managing, and mitigating these risks and challenges across multiple industries worldwide through knowledge, experience, innovation, dedication, cooperation and uncompromising integrity and professionalism.
Products
Agri-Analsyis LLC offers ELISA Reagents for detections of more than 200 plant viruses, 18 bacteria, one fungus and one Bt GMO, and testing supplies. For detailed product information, please select Product Items and Product information. Testing Supplies include ready-to-use test buffers, substrates, block reagents, surfactants, ELISA plates, plastic wares and much more.
Grapevine Testing and Other Services
If you have budwood you want to propagate, or, if you have a production problem in your vineyard, and it is related to the presence of one of the commonly-encountered viral, fungal, or bacterial plant pathogens of Vitis spp., there is a high probability of detection given the proper sample at the right time of the year. Agri-Analysis provides assays to detect the following grapevine pathogens:
For testing cost, please contact us or email us at info@agri-analysis.com or call 1.800.506.9852.
Knowing the Powdery Mildew Spore Count and Possible Fungicide Resistance in Your Vineyard can Help You Make an Informed Management Decision and Make Your Fungal Management Program More Targeted, Sustainable and Cost Effective.
Fungicide Resistance of Powdery Mildew. Based on research funded by the American Vineyard Foundation (AVF) in Washington, Oregon and California, over 90% samples tested were found to be resistant to QoI (Fran 11 Strobilurin) and about 60% were resistant to both QOI and DMI (Frac 3 triazoles & imidazoles). The QoI resistance is attributed to a single point glycine to alanine mutation at position 143 of cytochrome b gene (G143A). Determining DMI resistance is much more complex although a change from tyrosine to phenylalanine in the cytochrome 450 protein is known to result in higher DMI fungicide tolerance (Y136F).
Detection for Resistance. We use a combination of PCR and DNA sequencing molecular techniques to identify the G143A mutation associated with QoI resistance and the Y136F mutation. For example, the following two DNA sequences were obtained from two powdery mildew samples. One is wild type (#891-1) and another is mutated (#891-3). The wild type is sensitive to QoI treatment and the mutant type is resistant to QoI.
891-1+PMfwd
GCATTCTTGGGTTATGTTTTACCCTACGGGCAGATGAGCCTATGGGGTGCAACCGTTAAG
891-3+PMfwd
GCATTCTTGGGTTATGTTTTACCCTACGGGCAGATGAGCCTATGGGCTGCAACCGTTAAG
Sample Collection. E. necator survives the winter as mycelia infecting tissue inside dormant buds or as chasmothecia or cleistothecia – spore producing fruiting bodies found in bark crevices. On warm winter and spring days when moisture is abundant, chasmothecia burst and release ascospores that stick and germinate on the underside of leaves. This makes chasmothecia as the most important sources of overwintering inoculum in the vineyard. The aforementioned AVF research indicated that the composition of QoI resistant vs sensitive strains is different between spore samples in the air and those on the leaf. To obtain a more comprehensive survey of E. necator spore counts and possible resistance, it is important to take different types of samples from different parts of the vineyard throughout the growing season such as bud samples, leaf samples and air samples. Please call us for more details.
We encourage growers to monitor their vineyards for spore counts and possible resistance in order to make an informed decision and to make their fungal management program more targeted, sustainable and cost effective.
Please Note: Agri-Analysis is now screen for powdery mildew spore counts and possible fungicide Resistance. Please download a copy of our new sample submission form to send in together with your samples. Thank you.
Pinot Gris Virus (GPGV)
Red Blotch Virus (including virus titer and clade typing)
Powdery Mildew Fungicide Resistance (DMI and QOI)
Fanleaf Virus
Fungal screening in grafted vines
Agrobacterium screening in grafted vines
LR1, LR2 and LR3 Virus
10-virus combo panel
20-virus extensive panel
Alan Wei, Ph.D.
Agri-Analysis LLC
950 West Chiles Rd
Davis, CA 95618
tel: 800.506.9852
fax: 530.757.4655
www.agri-analysis.com
Grapevine & Seed Testing Since 1981
On March 2, Agri-Analysis hosted the first field day of 2018 organized by the Napa Valley Grapegrowers (NVG) Association. Napa growers got a behind-the-scene view of what happens to their vine samples upon reaching the lab, how to sample, how samples are processed, how samples are analyzed, and how to interpret results. The group was lead by NVG associate director Sonya Delucas and Kali Clark. Yolo County Supervisor Don Saylor and Deputy Ag Commissioner David Brown were on hand to greet the Napa visitors.
With many Napa grape growers on Yolo soil, Supervisor Saylor proclaimed "Welcome to the Wine Capital of California" - a proclamation that lasted for 3 abut hours. Lab tour was led by Dr. Neda Esteghlal for PCR setup, Andy Zinkl for Elisa setup, Dr. Triatan Eifler for PCR, RT-PCR, qPCR and DNA sequencing data analysis and Dr. Sara Rohkin for sample preparation. "Interactions like this are very important for us to learn growers needs first hand and to answer their questions, it help us better improve our services", said Dr. Alan Wei, general manger of Agri-Analysis. Agri-Analysis is a CDFA approved laboratory located in Davis, CA that tests grapevine samples for viruses, fungal pathogens, Pierce Disease, fungicide resistant powdery mildew etc.
Agri-Analysis Hosted Napa Valley Grapegrower Field Day on March 2, 2018, where growers got a behind-the-scene view of how their vine samples are tested in the lab
With many Napa valley grapegrowers on Yolo soil, Yolo County Supervisor Don Saylor Proclaimed "Welcome to the Wine Capital of California".
Grapevine powdery mildew (PM), caused by the fungal pathogen Erysiphe necator, is a major fungal disease in California and all grape growing regions of the world. Currently fungicide applications are the main control methods. In recent years, working with Dr. Walt Mahaffe's group of Oregon State University, Agri-Analysis has optimized testing methods for fungicicde resistant strains of E. necator in vineyard samples, particularly resistance to demethylation inhibitors (DMI) and quinone outside inhibitors (QOI).
Please call us at (800) 506-9852 for all you PM monitoring and testing needs. Agri-Analysis helps to protect your investment. Download a copy of our new sample submission form to send in together with your samples
In a letter to the industry on December 20, 2017, Dr. Deborah Golino, Director of Foundation Plant Services at UCDavis announced that Grapevine red blotch associated virus (GRBaV) has been found in the Russell Ranch* for the first time since its establishment in 2015. Five (5) vines out of 4,132 were tested positive for GRBaV. Dr. Golino believes that because that the three cornered alfalfa tree hopper was found in Russell Ranch, this occurrence of red blotch may be vector mediated. Molecular analysis showed 99% similarity to GRBaV isolates from two different groups, which indicates separate infection events. FPS has removed and destroyed the infected vines and notified a client who received cuttings from these vines. FPS is implementing additional precautions to prevent the spread of the vector and the virus. "We will continue to work to maintain a high testing standard for our foundation vineyards, making every effort to keep you informed", said Dr. Golino in her letter.
* Established in 2015, Russell Ranch is maintained by UCDavis Foundation Plant Services as a Foundation vineyard for the California Grapevine Registration and Certification program to supply clean cuttings to nurseries for propagation. All vines planted in Ranch Russell Ranch have met two strict criteria: (a) be generated using microshoot tip tissue culture therapy; and (b) tested negative for more than 37 grapevine viruses.
Complimentary Exhibit-Only Passes to Unified Symposium January 24-25
Agri-Analysis is pleased to exhibit at the Unified Symposium at Sacramento Convention Center on January 24-25. Please visit us at booth number #2606 to discuss updates on grapevine leafroll viruses, red blotch virus, and testing requirements under the USDA TAP program. Agri-Analysis provides disease testing services to grape growers and nurseries to ensure clean planting materials. We help protect your investments. If you need free exhibit-only passes to the Unified, please email us at info@agri-analysis.com with your name, affiliation, address, phone and email address. We look forward to seeing you in Sacramento.
USDA- FSA is currently still accepting applications for Red Blotch damaged vineyards. Red Blotch is now an accepted cause of loss under the Tree Assistance Program (TAP) in the whole state of California, previously it was only accepted in a few counties. Producers who wish to apply for benefits need to complete eligibility requirements with the County Office for which their vineyard is physically located. Additionally, producers need to sample at least 10 vines per varietal block they will apply for benefits on. Producers have 90 days to apply for benefits after they receive their Red Blotch Test Results. The TAP program has a 12-month expiration date from the date of approval. "A claim of loss due to Grapevine Red Blotch-associated Virus (GRBaV) must be verified through polymerase chain reaction (PCR) testing performed at a commercial laboratory.
To apply for TAP assistance, please contact your state and county FSA offices. A list of FSA offices is available here.
For testing, please download a sample submission form and send it with your samples to Agri-Analysis, 950 West Chiles Road, Davis, CA 95618. Additional Resources:
A number of growers have found black vascular streakings in their bench grafts destined for new planting. When they sent in samples to the laboratory, the black streakings were tested positive for Phaeomoniella, Phaeoacremonium and/or Cylindrocarpon by PCR anaysis.
These are three common fungal pathogens that can cause young vine decline and black foot disease. The primary source of inoculum is infected soil, but nursery plants are also a potential infection source. In a survey of 165 non-symptomatic rooted grapevine cuttings selected randomly from various nurseries in California in 2007, 26% tested positive for Cylindrocarpon in PCR assays".
For more information, please visit UCANR report and other reports. Symptoms to look for include the following: Please call Agri-analysis for further analysis if you see symptoms like these in your bench grafted planting materials.
(800) 506-9852 or email apwei@agri-analysis.com
A number of growers have found black vascular streakings in their bench grafts destined for new planting. When they sent in samples to the laboratory, th black streakings were tested positive for Phaeomoniella, Phaeoacremonium and/or Cylindrocarpon by PCR anaysis. These are three common fungal pathogens that can cause young vine decline and black foot disease. The primary source of inoculum is infected soil, but nursery plants are also a potential infection source. In a survey of 165 non-symptomatic rooted grapevine cuttings selected randomly from various nurseries in California in 2007, 26% tested positive for Cylindrocarpon in PCR assays". For more information, please visit UCANR report and other reports. Symptoms to look for include the following: Please call agri-analysis for further analysis if you see symptoms like these in your bench grafted planting materials.
[TAP (REV. 4) CA AMEND 1] "The STC has approved Grapevine Red Blotch-associated Virus (GRBaV), commonly referred to as "Red Blotch", as an eligible plant disease for select counties in California: Amador, Contra Costa, El Dorado, Fresno, Marin, Mendocino, Monterey, Napa, Riverside, Sacramento, San Joaquin, San Luis Obispo, San Mateo, Santa Barbara, Santa Cruz, Solano, Sonoma and Yolo. A claim of loss due to GRBaV must be verified through polymerase chain reaction (PCR) testing performed at a commercial laboratory.
A minimum of ten (10) symptomatic vines must be tested from each block claimed to be infected. This sampling, coupled with visual indictors identifiable to the FSA representative, will be used to determine the extent of damage.
Visual indicators may include, but are not limited to:
Red Varieties: reddening of underside secondary/tertiary veins, red blotches on leaves;
White Varieties: very pale yellow blotches and irregular chlorosis
Visual inspection requirement of claimed infected plants is waived for plants removed prior to September 10, 2014." For more information please contact your county FSA office or Ms Jennifer Blume, FSA, Templeton, CA at Jennifer.Blume@ca.usda.gov.
RED BLOTCH TESTING SERVICE BY AGRI-ANALYSIS. As a leader in grapevine virus testing, Agri-Analysis offers the following services for red blotch.
Organized Napa Valley Grapegrowers Association, ROOTSTOCK 2106 features high-level, provocative seminars and industry experts, vineyard and wine trials, Concept Bar, networking opportunities, and an exclusive exhibition featuring over 120 of the industry’s leading viticulture and enology companies. ROOTSTOCK connects vineyard practices to the betterment of wine quality. As a PREMIERE PARTNER of ROOTSTOCK 2016. NVG has graciously provided complimentary access to exhibit halls and a 10% discount to attend seminars for clients and associates of Agri-Analysis. To register online, please visit the link below and use the discount code: AGA.
https://napagrowers.ejoinme.org/MyEvents/2016ROOTSTOCK/TICKETING/tabid/810433/Default.aspx
Here, we would like to re-post an early study where we correlated the intensity of leaf symptoms with red blotch virus tier level.
Sample #1. Normal and green foliage: No RBaV was detected by conventional PCR the relative DNA copy number of RBaV was zero by quantitative PCR (qPCR).
Sample #2. Speckled red foliage: RBaV was positive by conventional PCR; the relative DNA copy number of RBaV = 200+/- by qPCR.
Sample #3. Complete red foliage: RBaV was strongly positive by conventional PCR. the relative DNA copy number of RBaV = 80,000+/- by qPCR.
Attached is the current information for TAP kindly provided by Jennifer Blume of County Executive Director, San Luis Obispo County FSA Office, 65 S. Main St Suite # 106, Templeton, CA 93465, (805)434-0396 Ext 2. The web page is listed on the back of the flyer, www.fsa.usda.gov. Growers could find the FSA office in their county in California and the contact information.
What is TAP? TAP is administered by the Farm Service Agency of the USDA. Under the Farm Bill of 2014, when a crop is affected by a natural disaster, the Tree Assistance Program (TAP) can provide financial assistance to qualifying orchardists and tree growers to replant or rehabilitate eligible trees, bushes or vines. Eligible trees, bushes and vines are those from which an annual crop is produced for commercial purposes.
Eligibility. To qualify, participants must have suffered a qualifying loss in excess of 18% mortality from an eligible disaster for an individual stand. Participants must turn in evidence of eligible disaster. For Red Blotch, a minimum of 10 symptomatic vines from each block must be verified through polymerase chain reaction (PCR) testing performed at a commercial laboratory. Participants must have owned the eligible trees or possess long term lease agreements.
"We have experienced a significant amount of Red Blotch infection in our vineyard near Jacksonville, OR. We have tracked the spread of the virus both through testing and mapping of symptoms. In the fall of 2015 we removed all symptomatic vines as well as many adjacent asymptomatic vines in an attempt to prevent the spread of this virus to uninfected portions of the vineyard. Out of 21.25 acres, 5.5 acres were removed. This was in addition to 0.9 acres that were removed in the fall of 2013 and replanted in the spring of 2014. Test results from a large sample grid showed that the occurrence of symptoms in 2015 corresponded to the presence of the virus at detectable levels. The symptomatic (and subsequently removed) portion of the vineyard was generally concentrated along the eastern edge of the vineyard, with symptoms and positive test results diminishing towards the west. As far as it was detectable through either testing or visual symptoms, there were no "infected" vines remaining in the vineyard as of spring 2016. As of this morning (September 2), the extent of symptoms is so severe and wide-spread throughout the vineyard that there seems to be no significant unaffected portion. Were we to remove plants under the same guidelines that we applied in 2015 there would likely be fewer than 2 acres of the 21.25 remaining. The onset of the symptoms appears to have occurred both rapidly and quite recently."
"My best guess is that most of this spread occurred prior to the 2016 season and remained below detection or symptom inducing thresholds. The grid testing that was done in 2014 and 2015 was recently repeated so there will soon be new test results to show any newly detectable infection. As for this year, I believe there was some (scant) evidence of tree-hopper activity observed in the vineyard but it should be noted that the vineyard was treated with a drip-applied neonicotinoid at the beginning of May and few hoppers of any type (and zero three-cornered alfalfa hoppers) were found despite frequent sampling by the local extension team. "
USDA RED BLOTCH PROGRAM IN OREGON AND CALIFORNIA
[TAP (REV. 4) OR AMEND 1] "The STC has approved Grapevine Red Blotch-associated Virus (GRBaV), commonly referred to as "Red Blotch", as an eligible plant disease for select counties:
A claim of loss due to GRBaV must be verified through polymerase chain reaction (PCR) testing performed at a commercial laboratory. A claim of loss due to GRBaV must be verified through polymerase chain reaction (PCR) testing performed at a commercial laboratory.
Visual indicators may include, but are not limited to:
Visual inspection requirement of claimed infected plants is waived for plants removed prior to September 10, 2014." For more information please contact your county FSA office or Ms Teresa Vonn, FSA Central Point, OR at Teresa.Vonn@or.usda.gov, or Ms Jennifer Blume, FSA, Templeton, CA at Jennifer.Blume@ca.usda.gov
NEW RESEARCH ARTICLES ON RED BLOTCH
1. Phylogeny of Geminivirus Coat Protein Sequences and Digital PCR Aid in Identifying Spissistilus festinus as a Vector of Grapevine red blotch-associated virus. by Bahder BW, Zalom FG, Jayanth M, Sudarshana MR. Phytopathology. 2016 Jul 27
2. Grapevine red blotch-associated virus is Present in Free-Living Vitis spp. Proximal to Cultivated Grapevines. by Perry KL, McLane H, Hyder MZ, Dangl GS, Thompson JR, Fuchs MF. Phytopathology. 2016 Jun;106(6):663-70.
3. Grapevine Red Blotch-Associated Virus, an Emerging Threat to the Grapevine Industry. by Sudarshana MR, Perry KL, Fuchs MF. Phytopathology. 2015 Jul;105(7):1026-32. Review.
4. Subcellular localization of grapevine red blotch-associated virus ORFs V2 and V3. Guo TW, Vimalesvaran D, Thompson JR, Perry KL, Krenz B. Virus Genes. 2015 Aug;51(1):156-8. doi: 10.1007/s11262-015-1205-x. Epub 2015 Jun 11.
5. Grapevine red blotch-associated virus Is Widespread in the United States. by Krenz B, Thompson JR, McLane HL, Fuchs M, Perry KL. Phytopathology. 2014 Nov;104(11):1232-40.
6. Association of a DNA virus with grapevines affected by red blotch disease in California. Al Rwahnih M, Dave A, Anderson MM, Rowhani A, Uyemoto JK, Sudarshana MR. Phytopathology. 2013 Oct;103(10)
SERVICES AND RESEARCH PROVIDED BY AGRI-ANALYSIS
Much research is needed to understand GRBaV, its effect, transmission and management. Please feel free to contact me if you have any questions or would like to share your observations and good practices.
Thank you!
Alan Wei, Ph.D.
Agri-Analysis LLC
950 West Chiles Road
Davis, CA 95618
tel: 800.506.9852
fax: 530.757.4655
www.agri-analysis.com
Grapevine and Seed Testing Since 1981
Confidentiality Statement: Information contained in this communication is confidential and proprietary to Agri-Analyis LLC intended for the designated recipient only, and shall not be forwarded or otherwise disclosed to any third party without the written consent of the sender. If you received this message in error, please contact Agri-Analysis LLC at (800)506-9852 or info@agri-analysis.com. Thank you for your cooperation.
Grapevine leafroll associated virus 3 (GLaV-3) is, arguably, the No. 1 most economically important virus in grapevine production and is designated as an exclusion pest in most certification programs. However, growers are often frustrated to find this virus in their vineyards and in certified nursery stocks. GLRaV-3 is known to be genetically highly variable. Such genetic variability can have significant implications in the detection of GLRaV-3 by molecular means and serological assays.
Since 2013, Agri-Analysis has developed a proprietary ELISA-based reagent that provides broader coverage of GLRa-V3 variants than the commercial reagent currently in use. The figure below is a set of data comparing the testing results of ten samples. One sample was tested positive for GLRaV-3 by both methods (left). Seven samples were first tested using cane samples (AA1, green) and re-tested using petiole samples (AA2, light green). The GLRaV-3 strain in these samples can only be detected by Agri-Analysis reagent but not by the Bioreba reagent. Two control samples were tested negative for GLRaV-3 by both methods. Sequencing analysis shows 80-85% homology in nucleotide sequence and 90-93% amino acid sequence with other known GLRaV-3 variants in gene bank. Because of these variablity, genetic based method such as PCR and qPCR using known primers fail to detect this variant(s). Currently, the new reagent is being used in California and Washington State Certification programs.
During the growth season, growers would prefer petioles samples over cane cuttings for virus testing due to the obvious need to preserve fruits. In order to address this question, Agri-analysis has tested large number of petiole samples for red blotch and leafroll 3. We have found that petioles and sucker cuttings give reliable results for red Bloch and leafroll 3...
We would like to share the latest incidence rate of red blotch based on all samples tested at Agri-Analysis during the past year. The graph below shows the monthly average percent of samples tested positive for GRBaV and GLRaV-3 among all samples submitted to Agri-Analysis for testing from April 2015 to March 2016. The highest incidence occurs in later summer and fall when growers sent in sympomatic samples for testing. The percentage of GRBaV and GLRaV-3 positive samples was as high as 70% and 40% respectively. In the spring, growers test large amount of dormant vines and grafted vines which do do not exhibit any symptoms. The percentage of GRBaV and GLRaV-3 positive samples was relatively lower, but GRBaV incidence still varied between 5% to 20% between January and March of 2016. Overall, for the 12-month period reported, the average positive rate was 20% and 10% for GRBaV and GLRaV-3, respectively, among all smaples tested at agri-analysis. Please feel free to email us at info@agri-analysis.com or call us at (800)506-9852 if you have any questions. Thank you.
Powdery mildew is a fungal disease that affects a wide range of crops including grapevines. The specific fungus that causes powdery mildew on grapes is Uncinula necator, causing grape growers millions of dollars annually. Dr. Walt Mahaffee’s research group of USDA-ARS at Oregon State University has demonstrated that growers could accurately quantitate grape powdery mildew spore level and make management decisions guided by inoculum density results derived by quantitative polymerase chain reaction (qPCR). Using the qPCR data, some growers were able to reduce fungicide applications by up to two sprays without increasing disease on leaves or fruit.
In collaboration with Walt's lab, Agri-Analysis has now, for the second season, offered the traps and inoculum quantitation services to California growers and vineyard management companies. Please call (800)506-9852 or email us info@agri-analysis.com for more details. For more information on PM management, please visit the UCDavis IPM web site: http://www.ipm.ucdavis.edu/PMG/r302100311.html
As a CDFA approved testing labortory (permit # 057-11), Agri-Analyis uses polymerase chain reaction (PCR) to test grapevine red blotch associated virus (GRBaV) to help growers qualify for the USDA Tree Assistance Program (TAP). TAP provides financial assistance to eligible growers to replant or rehabilitate eligible trees, bushes and vines lost by natural disasters. Eligible trees, bushes, and vines are those from which an annual crop is produced for commercial purposes.
Please read the following documents for eligibility and application process:
Tree Assistance Program (TAP) Fact Sheet
Approved Disease – Grapevine Red Blotch is an eligible plant disease for select counties in California:
For more information on Farm Service Agency (FSA) disaster programs, visit http://disaster.fsa.usda.gov or visit your local FSA county office. Visit to find your local FSA county office.
Grapevine leafroll associated virus 3 (GLaV-3) is, arguably, the No. 1 most economically important virus in grapevine production and is designated as an exclusion pest in most certification programs. However, growers are often frustrated to find this virus in their vineyards and in certified nursery stocks. GLRaV-3 is known to be genetically highly variable. Such genetic variability can have significant implications in the detection of GLRaV-3 by molecular means and serological assays.
Since 2013, Agri-Analysis has developed a proprietary ELISA-based reagent that provides broader coverage of GLRa-V3 variants than the commercial reagent currently in use. The figure below is a set of data comparing the testing results of ten samples. One sample was tested positive for GLRaV-3 by both methods (left). Seven samples were first tested using cane samples (AA1, green) and re-tested using petiole samples (AA2, light green). The GLRaV-3 strain in these samples can only be detected by Agri-Analysis reagent but not by the Bioreba reagent. Two control samples were tested negative for GLRaV-3 by both methods. Sequencing analysis shows 80-85% homology in nucleotide sequence and 90-93% amino acid sequence with other known GLRaV-3 variants in gene bank. Because of these variablity, genetic based method such as PCR and qPCR using known primers fail to detect this variant(s). Currently, the new reagent is being used in California and Washington State Certification programs.
WiVi Central Coast, is the premier wine and viticulture symposium and trade show in Central California. Now the largest wine industry event south of San Francisco, WiVi boasts 45,000 sq. ft. of exhibit space with nearly 200 exhibits and hundreds of new products, product demonstrations, educational seminars and networking opportunities for winemakers, grape growers, winery owners and managers.
The day-and-a-half conference and one-day tradeshow features concurrent sessions by top industry leaders on regional viticulture, enology and DTC topics and gives attendees the opportunity to understand and experience new trends and technology.
For agenda and registration, please visit http://wivicentralcoast.com/
Red Blotch Update
Time: 11:30 a.m. - 12 p.m. Tuesday, March 15, 2016
Location: Ponderosa Pavilion
(Viticulture Track)
Interest in, and concern about, the disease known as Red Blotch has taken California by storm. It was originally thought to be a relatively new disease but recent research indicates that it may have been in California for many, many years. There have been major advances in the detection of the disease and important discoveries on how it spreads. New information is being revealed continuously and this presentation from the leading Red Blotch expert will update you on the latest findings.
Speaker: Alan Wei, Owner, Agri-Analysis
Wine Business IQ March 2, 2016
On Wednesday, March 2, 2016, Dr. Alan Wei was honored to have shared the stage with a distinquished panel of wine makers and viticulturist at the Wine Business IQ at Tasting Session: Effects of Red Blotch on Wine Quality.
During the Regional IPM Centers' multi-speaker webinar on red blotch disease, organized by regional IPM centers last Friday, UCD and USDA-ARS Researchers Dr. Brian Bahder, Dr. Mysore "Sudhi" Sudarshana and Dr. Frank Zalom reported their discovery of three-cornered alfalfa treehopper (ATH), scientific name: Spissistilus festinus) as a likely vector to transmit red blotch associated virus (GRBaV). In their experiments, they selected four candidate groups: one treehopper (20 insects), two leafhoppers (70 insects), one jumping plant lice (10 insects), and one planthopper (10 insects). Insects were allowed to feed on virus infected grapevines and released individually onto virus-free grapevines. At a 5-month test under green house conditions, three of the 15 plants exposed to three-cornered alfalfa tree hoppers (ATH) became positive for GRBaV. Insects from other groups did not show any transmission although some of them did acquire GRBaV in their system when fed on infected vines.
Additional information and photos of three cornered alfalfa tree hopper can be found on UCDavis IPM web site. Clearly, more studies are needed to understand the phenology of this insect and to develop effective management strategies. Some questions remain to be answered include:
1. Is ATH the only vector to transmit GRBaV or there are other insects involved?
2. What is the distribution and prevalence rate of ATH in California vineyards and other major wine growing regions of the U.S.?
3. Is ATH responsible for the spread of RB in California vineyards? or lack thereof in other states and other countries?
4. Does ATH transmit other viruses besides red blotch?
5. What should growers do to manage ATH in their vineyards?
Other Important Events This Week
Wine Business Innovation and Quality March 2, 2016
Innovation + Quality (IQ) 2016 is the second annual forum for ultra-premium wineries focused on cutting-edge innovations that advance wine quality. This day-long event will take place March 2, 2016 at Charles Krug Winery in Napa Valley.
Napa Valley Growers Sustainable Vineyard Practices Part II
Each year, the pest & disease pressures we face in our vineyards continues to increase, and it is suggested that the recent warm growing seasons and drought conditions have contributed to a reemergence of Pierce’s Disease and an increase in Powdery Mildew and grapevine trunk diseases in Napa vineyards. If you have challenges with any of these diseases, this is one session you don’t want to miss.
The following multi-speaker Webinar invitation kindly provided by Dr. Frank Zalom of UC Davs and Dr. Mysore Sudarshana of UCD-USDA ARS. I hope you will be able to attend this important update on red blotch research.
"Grapevine red blotch disease and the virus associated with it has been confirmed in many major grape production regions of the United States and Canada. Since the identification of the virus in 2011, several teams of researchers from across North America have been intensely characterizing the disease and effects on grapevines, as well as characterizing the virus, its spread, and potential management. Considerable progress has been made, but much remains unknown. Speakers representing many of these labs will be presenting their work and what it means for the grape industry."
Agenda (note that times are Pacific)
10:00
Welcome and Introduction
Frank Zalom, UC Davis
10:05
History of red blotch, symptoms and significance
Mysore Sudarshana, USDA-ARS, Davis, CA
10:20
Etiology of red blotch
Marc Fuchs, Cornell University, Geneva, NY
10:35
Detection and genetic diversity of the virus
Keith Perry, Cornell University, Ithaca, NY
10:50
Effect of red blotch on grapevine performance
Rhonda Smith, UC Cooperative Extension
11:05
Red blotch situation in Oregon
Vaughn Walton, Oregon State University and Bob Martin, USDA-ARS, Corvallis, OR
11:20
Red blotch and the virus in Canada
Sudarsana Poojari, Agri-Canada, Canada, T. Lowery, A-M. Schmidt, M. Rott, and J.R. Urbez-Torre
11:35
Red blotch and the virus in Europe
Jean-Sebastian Reynard, Agroscope, Switzerland
11:50
Virus Spread, disease gradient, and insects
Brian Bahder, UC Davis
12:05
FPS and NCPN, Protecting the supply chain of grapevines from red blotch
Deborah Golino, FPS, UC Davis
12:20
Question and Answer
Speakers (moderated by Frank)
For more information on the speakers, click here
If you need more information about the webinar, please contact Frank Zalom at fgzalom@ucdavis.edu .
New Webinar on Red Blotch: UCDavis and Cornell Researchers have announced a joint webinar on Feburary 26 at 10:00 AM PST to update the community on latest research results on red blotch. There will be about nine speakers and the agenda and registration link will be released shortly. Once it's available, it will be posted here.
TAP Assistance Approved in Oregon: USDA approved Oregon for assistance in replanting red blotch infected vineyards. For more information, please contact teresa.vonn@or.usda.gov. The testing requirement in California is 10 infected plants per block. We are still waiting from USDA Oregon office on specific testing requirements.
GPGV Update: A new Disease Note article was published in the peer reviewed journal of Plant Disease entitled "Occurrence of Grapevine Pinot gris virus in Commercial Vineyards in the U.S.". This was co-authored by Agri-Analysis satff and collaborators in Italy and Stamp Viticulture Inc. Publicly accessible abstract reads as follows:
"Grapevine Pinot gris virus (GPGV) was first identified in grapevine cv. Pinot gris in Northern Italy in 2012. It has not been reported in the U.S. until recently. Al Rwhanih et al (2015) surveyed foundation plant collections at the University of California, Davis. Out of 2014 plants surveyed, they found GPGV in one vine of a rare collection cv. Touriga nacional. Here we report the finding of GPGV in cvs. Chardonnay, Cabernet Sauvignon and Cabernet franc - grapevine varieties most commonly cultivated in commercial vineyards in the U.S. Further studies are required to assess its prevalence rate and economical impact on vine productivity and grape quality."
For more info, please visit APS web site at http://apsjournals.apsnet.org/doi/abs/10.1094/PDIS-01-16-0055-PDN. Agri-analyis has been testing for GPGV since October, we regularly find GPGV in California grapevine materials. Please contact us info@agri-analysis.com if you are interested in testing GPGV.
A grapevine virus discovered in 2012 by Italian researchers using next generation sequencing (NGS) as grapevine Pinot Gris virus (GPGV) and associated with disease symptoms in Pinot Gris in northern Italy since 2003, was recently detected in California grapevines in Napa Valley.
GPGV Highlights:
GRAPEVINE VARITIES GPGV WERE REPORTED:
GPGV LITERATURE:
Dr Alan Wei and Dr. James stamp will speak at annual NVG ROOTSTOCK exhibition and seminars at 12:30 on Thursday, Nov 12. For complete event schedule, please visit NVG web site (https://www.napagrowers.org/events/nvg-events-2015/rootstock/event-schedule/). For complimentary tickets and 10% discount on seminars, please register here (https://napagrowers.ejoinme.org/MyEvents/Home/IndustryAssociationsSponsors/tabid/717682/Default.aspx) using the discount code: AGA:
Title: Importance of Independent Evaluation of Certified Planting Materials.
by Agri-Analysis and Stamp Associates Viticulture
SYNOPSIS: Intensive virus testing of certified nursery increase block vines and finishing green and dormant grapevine nursery stock continues to demonstrate that due diligence in selection of planting materials is prudent. Testing of increase blocks should be prefaced by careful visual examination in order to reject questionable sources before sampling. We continue to find high levels of economically important viruses in grapevine stock derived Sent from my iPhone
Grapevine Red Blotch associated virus and leafroll virus type 3 are most frequently found in certified stock. Other exclusion viruses are also found. To-date fan leaf virus has not been found in certified stock.
With the recent outbreak of Pierce’s Disease in many parts of the North Bay and ongoing problems with fungal induced trunk diseases such as Eutypa and Bot canker, it is crucial to independently evaluate propagation source materials for their cleanliness in order to avoid costly replanting. We will report on findings from propagation and vine evaluations during the 2015 growing season and comment on trends and recent observations.
Many growers have called to ask for testing requirements in order to qualify for USDA Assistance under the TAP program. The following is excerpted form the USDA guideline: "A claim of loss due to Grapevine Red Blotch-associated Virus (GRBaV) must be verified through polymerase chain reaction (PCR) testing performed at a commercial laboratory.
To apply for assistance, please contact your state and county FSA offices. A list of FSA offices is available here. For testing, please download a sample submission form and send it together with your samples to Agri-Analysis, 950 West Chiles Road, Davis, CA 95618.
Additional Resources:
Innovative Reagent Detects Broader LR3 Variants
Agri-Analysis has developed a new reagent that can detect broader leafroll 3 variants than the current commercial reagent for leafroll 3 (BIOREBA). The new reagent is being used by state certification programs, universities in several countries including Australia, New Zealand, France, Israel and Spain in their testing and monitoring of GLRaV-3 in vineyards and nursery stocks. To read more detail, please visit Wine Industry Network or download a copy of our news release.
New Shipping Address
It's an exciting new day with a brand new shipping address! I am pleased to let you know that effective this week, our new shipping address is:
Agri-Analysis LLC
950 West Chiles Road
Davis, CA 95618.
We request that you ship samples to this new location together with a copy of the sample submission form. If you have shipped to the old location, we are still able to receive them. Our phone numbers and email address remain the same. Please be assured that testing is on-going without interruption and your samples are processed with the rapid turnaround that you have always expected of us.
We are very excited about the move back to Davis. Our new location is on the UCD bike path with a beautiful environmental envelope bordering Putah Creek and UCD facilities. It takes 3 min by bike and 10 min by walk to get to Campus center. It is easily accessible from Richard Blvd South exit and Research Park Drive (map below). Ready access to campus resources would undoubtedly help enhance our capacity to better serve you.
Please do not hesitate to stop by to visit us when you are in the Davis area. Please contact me if you have any questions or need any more information.
Sincerely,
Alan Wei
Laboratory Manager
950 West Chiles Road
Davis, CA 95618
1.800.506.9852
apwei@agri-analysis.com
Leafroll infection in red cultivars has been traditionally known to be manifested by green veins and red leaves. With the emergence of red blotch, symptom-based diagnosis has become more challenging. Here we would like to share a couple of photos of Pinot Noir 777 on 3309 from a vineyard in southern Oregon.
Photo 1. Pinot Noir 777 on 3309 from Southern Oregon planted in 2010, tested positive for red blotch but negative for LR3
Photo 2. Pinot Noir 777 on 3309 from Southern Oregon planted in 2014, tested positive for LR3but negative for red blotch.
Referring to the challenges of visual based diagnostics, Dr. Mark Fuchs of Cornell University commented to Oregon growers that "welcome to the world of confused people." For accurate diagnosis of your vineyard condition, please call Agri-Analysis at (800)506-9852 or email us at info@agri-analysis.com.
Many growers have called to ask for testing requirements in order to qualify for USDA Assistance under the TAP program. The follwoing is exerpted form the USDA guideline: "A claim of loss due to Grapevine Red Blotch-associated Virus (GRBaV) must be verified through polymerase chain reaction (PCR) testing performed at a commercial laboratory.
For testing, please download a sample submission form and send it together with your samples to Agri-Analysis, 930 Riverside Parkway, Suite #30, West Sacramento, CA 95605. Please call (800)506-9852 or email info@agri-analysis.com if you have any questions.
State Office – California 430 “G” Street, #4161
Davis, CA 95616-4161
(530) 792-5520
CALIFORNIAUSDA FSA SERVICE CENTERS
CED – County Exec. Director FLM – Farm Loan Manager FLO – Farm Loan Officer
SFLO-Senior Farm Loan Officer
Butte
150 Chuck Yeager Way Oroville, CA 95965-9215
(530) 534-0112
CED: Billy Merritt FLM: Shaleen Hogan
(530) 527-3013 (Red Bluff)
Colusa
100 Sunrise Blvd., Ste. D Colusa, CA 95932-3246
(530) 458-5131
CED: Denise Nannen FLM: Shaleen Hogan
(530) 934-4669 (Willows)
Fresno
4625 W. Jennifer, #109
Fresno, CA 93722-6424
(559) 276-7494
CED: Russ Friend FLO: Chantal Haun
Glenn
132-A N.Enright Ave. Willows, CA 95988-2716
(530) 934-4669
CED: Don Perez FLO: Kathy Aguiar
Humboldt/ Del Norte
5630 S. Broadway
Eureka, CA 95503-6998
(707) 442-6058
CED: shared mgmt w/ Katie Delbar, CED Mendocino/Lake FLO: Karri Bartolomei
(707) 468-5278 (Ukiah)
Imperial
177 N. Imperial Ave.
El Centro, CA 92243-2308 (760) 352-4418
CED: Rosa Singh SFLO: Tom Hunton
(661) 336-0967 (Bakersfield)
Kern
5000 California Ave., Ste. 100
Bakersfield, CA 93309-0711
(661) 336-0967
CED: Garrett Pedretti SFLO: Tom Hunton
Kings
680 Campus Dr., Ste. C Hanford, CA 93230-3556
(559) 582-1071
CED: Kathy Sargent FLM: Tom Roberts
(559) 734-8732 (Visalia)
Lassen/ Plumas / Sierra
12950 Riverside Dr.
Susanville, CA 96130-4170
(530) 257-4127
CED: shared mgmt w/ Chris Lauppe, CED, Modoc FLM: Katherine Lewis (530) 824-6123 (Yreka)
Los Angeles / Orange / San Bernardino
44811 N. Date Ave., Ste. B Lancaster, CA 93534-3136
(661) 942-9549
CED: Doug Brand SFLO: Tom Hunton
(661) 336-0967 (Bakersfield)
Madera
425 N. Gateway Dr. Ste. E Madera, CA 93637-3187
(559) 674-4628
CED: Joe Grillo
FLM: LaVon Treasure (209) 725-2964 (Merced)
Mendocino/ Lake
1252 Airport Park Blvd. - B1 Ukiah, CA 95482-5979
(707) 468-9225
CED: Katie Delbar FLO: Karri Bartolomei
Merced/ Mariposa
2926 G St. #103
Merced, CA 95340-6445
(209) 722-2110
Acting CED: Joe Grillo (CED Madera)
FLM: LaVon Treasure
Modoc
802 W. 12th St.
Alturas, CA 96101
(530) 233-4391
CED: Chris Lauppe FLM: Katherine Lewis (530) 842-6123 (Yreka)
Monterey/ San Mateo / Santa Cruz
744 LaGuardia St. Ste. A Salinas, CA 93905
(831) 424-7377
CED: Vivian Soffa FLO: Enoy Guevara
Riverside/ San Diego
82-901 Bliss Ave.
Indio, CA 92201-4399
(760) 347-3675
CED: Desiree Houston SFLO: Tom Hunton
(661) 336-0967 (Bakersfield)
Sacramento/ Amador /
Placer/ El Dorado
9701 Dino Drive, Ste. 107 Elk Grove, CA 95624 (916) 714-1104
CED: Ted VanSteyn FLM: Belle Davis
(209) 472-7127 (Stockton)
SanBenito/ Santa Clara 2337 Technology Parkway, Ste A Hollister, CA 95023-2544
(831) 637-4360
CED: Jeannine Leyva FLO: Enoy Guevara (831) 424-7289 (Salinas)
SanJoaquin/ Alameda / Calaveras / Contra Costa / San Francisco
3422 W. Hammer Lane, Ste. C Stockton, CA 95219
(209) 472-7127
CED: Jeff Torres FLM: Belle Davis
SanLuisObispo
65 Main St., Ste.106 . Templeton, CA 93465
(805) 434-0398
CED: Jennifer Anderson FLM: Gary Troester
(805) 928-9269 (Santa Maria)
Santa Barbara / Ventura
920 E. Stowell Rd.
Santa Maria, CA 93454-7008 (805) 928-9269
CED: Brenda Farias FLM: Gary Troester
Shasta / Trinity
3644 Avtech Parkway, Ste. D Redding, CA 96002
(530) 226-2560
CED: Shared mgmt w/ Darci Cullers, CED Tehama FLO: Sandy Davidson
Siskiyou
215 Executive Court, Ste. C Yreka, CA 96097-2693
(530) 842-6123
CED: Joseph Ulics FLM: Katherine Lewis
Solano/ Napa
1170 N. Lincoln St., Ste. 109
Dixon, CA 95620-4001
(707) 678-1931
Acting CED: Laura VanHoose (CED Solano, Napa)
FLM: Belle Davis
(209) 472-7127 (Stockton)
Sonoma/ Marin
1301 Redwood Way, Ste. 190 .
Petaluma, CA 94954-1136
(707) 664-8593
CED: Lisa Velasquez FLO: Karri Bartolomei (707) 468-9225 (Ukiah)
Stanislaus / Tuolumne
3800 Cornucopia Wy.,Ste. E Modesto, CA 95358-9492
(209) 491-9320
CED: Jonna Spaletta FLM: Vacant
Sutter/ Yuba / Nevada1521 Butte House Rd,Ste. A Yuba City, CA 95993-2236 (530) 671-0850
CED: Lance Carter FLM: Ehab El Liessy
Tehama
2 Sutter Street, Ste. C Red Bluff, CA 96080-4353 (530) 527-3013
CED: Darci Cullers FLM: Shaleen Hogan
Tulare
3530 W. Orchard Ct. Visalia, CA 93277-7360
(559) 734-8732
CED: Kaye Rydberg FLM: Tom Roberts
Yolo
221 W. Court, Ste. 3B Woodland, CA 95695
(530) 662-3986
CED: Marianne Morton FLM: Ehab El Liessy (530) 671-0850
(Yuba City)
Alpine / Inyo / Mono
Yerington Office
215 W. Bridge St. #10A Yerington, NV 89447-2582
(775) 463-2855
CED: shared mgmt w/ Betty Hodik, CED Lyon County, NV Farm Loan Chief: Carolyn Persinger (775) 784-5411
(Reno, NV)
I had the great pleasure of attending the 18th International congress on viruses of the grapevine (ICVG) held on September 7-11 in Ankara, Turkey. Every three years, ICVG brings together the world's best and brightest minds to report on the cutting-edge research on grapevine viruses and associated diseases. Last time when ICVG met in Davis in 2012, the discovery of red blotch virus was announced. No new virus has received more attention by California growers than the grapevine red blotch virus. Hereby I would like to provide you with an update on red blotch research from the 18th ICVG summarized to the right column. Please feel free to contact me for any further details.
In addition to red blotch, advances in new technology such as next generation sequencing have enabled the discovery of other new viruses. Some examples are as follows.
Looking into the future, Professor Martelli of Italy presented the following insight - a view shared by his colleagues in their joint publication. The challenge and target of future research is not so much the development of more refined and highly performing techniques for the recognition and elimination of viruses but, rather, the design of dependable strategies for preventing a quick sanitary deterioration of vineyards planted with costly certified materials (Maliogka V, Martelli GP, Fuchs M, Katis NI, 2015, Advances in Virus Research 91, 175-227.)
To this end, we continue to encourage growers to be vigilant to survey existing vineyards so as to remove an infected vines and to test new planting materials so as to prevent any infected vines from being planted in new vineyards.
Please contact us for further details at info@agri-analysis.com or (800)506-9852.
Thank you!
Sincerely,
Dr. Alan Wei
Laboratory Manager
Agri-Analysis LLC
930 Riverside Parkway, Suite #30
West Sacramento, CA 95605
1.800.506.9852
apwei@agri-analysis.com
www.agri-analysis.com
Download Red Blotch Brochure
Red Blotch Research Update from Dr. Marc Fuchs of Cornell University.
Red Blotch Research Update from Dr. Naidu Rayapati of Washington State University.
Red Blotch Research Update from Dr. Jean-Sebastien Reynard of Switzerland.
GRBaV should be included in certification program
Photos from 18th ICVG September 7-11.
Dr. Deborah Golino presenting on leafroll virus effect on various cultivar/rootstock combinations
Dr. Marc Fuchs presenting on Red Blotch
Dr. Maher Al Rwahnih presenting on NGS
Dr. Naidu Rayapati Presenting on WA VineyardsTurkish Emir white grape in central Anatolia region.
Turkish Kalecik red grape grown near Ankara
Group photo in Cappadocia - Turkey's heartland
Photo with Professor Filiz Ertunc (3rd right) and her students of University of Ankara and Dr. Nuredin Habili of University of Adelaide Australia (2nd right).
For further details, please visit http://icvg2015.org/.
Innovative Reagent Detects Broader LR3 Variants
Agri-Analysis has developed a new reagent that can detect broader leafroll 3 variants than the current commercial reagent for leafroll 3 (BIOREBA). The new reagent is being used by state certification programs, universities in several countries including Australia, New Zealand, France, Israel in their testing and monitoring of GLRaV-3 in vineyards and nursery stocks. To read more detail, please visit Wine Industry Network or download a copy of our news release.
Red Blotch Diseases and Virus Status in CDFA Certified Nursery Blocks
An article by James Stamp and Alan Wei, Wine Business Monthly, August, 2014. This article may be downloaded from any of the sources below.
1. Agri-Analysis
2. Napa Valley Grapegrowers
3. Wine Industry Network
4. Lodi Wine Growers
5. Wine Business Monthly
6. Vineyard Team
BROCHURES AND LITERATURE ON GRAPEVINE RED BLOTCH VIRUS.
Agri-Analysis Brochure and other literature is online
UCDavis/USDA-ARS Brochure is available online
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. With publisher's permission.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact S cott at AVF, Michael Sipiora or Bob Steinhauer.
Dear Growers,
We would like to report the status of red blotch and leafroll 3 viruses in California vineyards. The graph below shows the percentage of positive samples in all samples tested at Agri-Analysis for past three consecutive growing seasons. This set data represents results from a large number of grapevines from various sources including existing vineyards and new planting materials. We can see that red blotch virus has taken over leafroll 3 as the #1 most economically important grapevine virus. During the past three planting seasons, the infection rate of red blotch virus varied between about 15% to 25% while the infection rate of leafroll 3 virus hoovers around 10%. These results are significant due to the large numbers of samples tested. We continue to encourage growers to be vigorous to test new planting materials so as to prevent any infected vines from being planted in new vineyards. Please contact us for further details at info@agri-analysis.com or (800)506-9852. Thank you.
Grape Growers have reported more incidences of PD this spring than in past years. Pierce's disease is caused by the infection of pathogenic bacterium Xylella fastidiosa. Unlike viruses that are limited in the phelom tissues, Xf is limited in xylem tissues and unevenly distributed. When sampling for PD, please be sure to include this year green shoot as well as lignified canes from previous year. Agri-analysis uses both ElIsa and PCR to ensure accuracy of the results at no additional cost to growers. Thanks for choosing Agri-Analysis, We Help Protect Your Investment, since 1981.
An opportunity to improve the quality of vines available to US winegrape growers
The California Grapevine Registration & Certification Program, administered by CDFA, aims to eliminate specific grapevine diseases such as leafroll, fanleaf, corky bark, stem-pitting and fleck that are spread from vine to vine by grafting and/or vegetative propagation1.
However, for many years, grape growers have been frustrated by the fact that CDFA certified grapevine nursery stock available from participating California grapevine nurseries are often found to be contaminated by these regulated viruses2-3.
The Grapevine Red Blotch associated Virus (GRBaV), described in fall of 2012 as the cause of leaf reddening and retarded ripening in wine grapes, helped growers to re-focus on the issue of cleanliness of their planting materials.
The availability of a PCR based diagnostic test for GRBaV confirmed that red blotch was widespread in both scions and rootstocks of CDFA certified grapevine nursery stocks. This led to the cancellation of shipment of unprecedented number of vines from California grapevine nurseries to vineyard sites all over the U.S.
Over the years, we have conducted field observations and laboratory testing of certified scion increase blocks which are the source of CDFA certified budwood for grafting. Increase blocks of important budwood clones were found to be contaminated with leafroll virus 3 and/or GRBaV.
We also found that finishing dormant plantings in CDFA certified nursery rows were contaminated with LR3 and/or GRBaV. While previously ordered nursery stock was cancelled because of LR3 and GRBaV contamination, growers still had to plant vines due to legal and economical considerations.
This led to a scramble to search/re-search and test/re-test copious volumes of scion and rootstock materials in order to find clean grafting stock. Through this process grape growers came to the painful realization that CDFA certified nursery stock could not provide them with clean grapevines free of economically important viruses (EIV), which was contrary to what they had expected.
Since spring 2014 an ad hoc committee of concerned growers and vine specialists was formed. The committee met regularly at Caldwell Vineyard in Napa with the goal of promoting changes in the CDFA regulation. Meetings were also held with CDFA, FPS and nurseries.
As a result of these activities, a public meeting was held in Sacramento in December 2014 where Joshua Kress, program manager of the CDFA’s nursery certification program, presented current requirements for testing, inspection, eligibility and traceability on foundation blocks, increase blocks and certified nursery plantings.
Current Disease Testing Frequency:
Current Inspection Frequency:
Current Record-keeping/Traceability Requirements
Revision to the CDFA grapevine nursery certification program should include addition of GRBaV as a regulated pathogen and address defects in protocol that do not provide sufficient protection against easily vectored viruses. For example, the program currently calls for testing of key viruses every five years.
Given the widespread occurrence of mealybug, vectors of Leafroll 3 virus, the sampling frequency should be increased from every five years to every year. In addition, the program’s current sampling protocol for in-field increase block vines and finishing nursery stock is poorly defined and inadequate to provide statistically confident results.
Furthermore, the current program calls for visual inspection of all CDFA rootstock and scion increase blocks at least once a year. This is a critical step in securing clean material as visual evaluation of vines in fall can readily identify the presence of disease.
However, this is not a job for the untrained, and requires inspection of every vine at precisely the right time when symptoms are present. Top-work should not be allowed in the program. One of the biggest hurdles to development of an effective system is available funding.
It is imperative that the public search out the CDFA to comment on the existing program and that key industry stakeholders (e.g., growers, nurseries, FPS and CDFA) work together to develop an effective and transparent program, which will lay the foundation of clean grapevine planting stock for years to come.
Expert Editorial
by James A. Stamp, Ph.D., Stamp Associates, Sebastopol, CA
and Alan Wei, Ph.D., Agri-Analysis, LLC, West Sacramento, CA.
“We have had at least one other sample from another vineyard that yielded positive results with the Agri-Analysis reagent but negative for the BioReba."
Since we reported the discovery of new LR3 testing reagent developed by Agri-Analysis last summer, we have received many inquries from US and other parts of the world. Some colleagues have spent time to evaluate and report results back to us. Here I would like to share some comments and/or results. To our knowledge, the reagent is now being used by California and Washington State grapevine certification programs.
From a Renowned University in Washingon State: “We have had at least one other sample from another vineyard that yielded positive results with the Agri-Analysis reagent but negative for the BioReba. In that case, we confirmed that the vine was infected by RT-PCR. The test works very well and yields clean results. Thank you for introducing us to this reagent.”
From a Renowned Unversity in New York: “We recently tested your GLRaV-3 detection reagents along with the lyophilized tissue infected with two isolates that show a differential reaction to different sets of antibodies. Tests were run on two different dates with 33 infected samples from New York, the two lyophilized samples from Agri-Analysis and two healthy samples. The reaction was read 1hr after the addition of the substrate. Attached are the results”
From a Renowned University in California. “Our TaqMan assay does not detect your LR3 isolate.”
From a private lab in New Zealand. “One sample was not detected with Bioreba antibodies, but positive with the Agri-Analysis antibodies. Both the samples you (very kindly) sent me had a much stronger positive with Agri-Analysis than with Bioreba. Do you know what strains the two samples you sent me are?”
From a Renowned University in Australia: “Agri-analysis ELISA kit works very well on a wide range of Leafroll virus 3 strains.” “ This sample was taken from a mild strain of leafroll virus, isolated from a Crimpson seedless Table grape in WA. “The virus causes the berries to grow bigger, crispier and lighter in colour. We called the good LR3 (Versus the bad one). Take home message: I would recommend ordering Alan’s kit for ELISA.”
From a viticulturist in Israel: “I am a viticulturist in Golan Heights Winery which is considered to be one of the best wineries in Israel and also have good recognition in the world. Dr. XX attached in our last communication an article you wrote (Agri-Analysis Develops Leafroll 3 Virus Testing Reagent that Could Impact State Certification Programs).“ In Israel, LR3 is a major virus (the most common and also causes the most economic loses). We had many years trying to figure out what we are dealing with and consulted with the world's biggest experts on the subject. We imported clean new materials, established new propagation blocks and planted new vineyards. At the moment we identify in our new relatively clean vineyards some symptoms that looks very clearly as symptoms for LR3. The trouble is that when we send samples to the lab we are getting mostly negative results which is very surprising to us (and this is consistent with different labs). “Dr. XX suggested which makes great sense, that this might be a different variant of LR3 and this can be detected only by ELISA. To my knowledge the Lab that we are working with is using the Bioreba kit, and I am very interested to hear from you about the kit you have developed.”
From a Renowned Research Institute in France. “We are using BioReba reagents, but sometimes we suspect that some isolates escape detection with them. Great that you agree to send us a sample of your new GLRaV-3 antiserum”. “We have several vines that were LR3-positive a few years ago, but negative more recently using the BioReba reagents, and we would like to see what happened.”
As growers prepare for the busy planting season, it is important to screen viruses status of new planting materials regardless of their source and origin. Last August, Stamp and Wei reported the virus status of CDFA-certified grapevine nursery blocks based on our combined experience of testing tens of thousands of plants from various sources. In that article, several growers also expressed their frustration over the fact that economically important viruses such as LR3 and red blotch are frequently found in CDFA certified planting materials. The Canadian national inspection agency also reported high incidence of virus levels in grapevine materials imported from California certified sources.
A group of concerned growers met a number of times last year in Napa to identify problems and discuss solutions. These activities led to the CDFA decision to open the review process of the California Grapevine Registration and Certification program. The first public meeting was held on December 18th in Sacramento. The issues discussed included disease testing and inspection frequency, record-keeping and traceability requirements. More meetings are planned in the future. The CDFA has added a new webpage dedicated to the Grapevine R&C Program. Growers are encouraged to contact Josh Kress if you have any comments regarding the regulation that you would like to be considered
I will look forward to seeing you to catch up on these and other exciting happenings in our industry. Agri-Analysis will exhibit at Booth #225 together with Advanced Viticulture Inc. I look forward to seeing you at the conference. Thank you!
Agri-Analysis to Exhibit at Unified Symposium Booth #225
When: January 28-29, 2015
Where: Sacramento Convention Center
Time: 9:00 am - 6:00 pm
We have a few extra exhibit hall only passes. If you need them, please email us with your name and email and affiliation, we will register you. Also, you are cordially invited to join us at the Capitol Garage for a happy hour/dinner. Please RSVP here.
When: Wednesday January 28, 2015
Where: Capital Garage
1500 K Street, Sacramento, CA 95814
(916)444-3633
Time: from 5:30 pm
Innovative LR3 Reagent Update
As reported earlier, Agri-Analysis has developed a new reagent that can detect broader leafroll 3 variants than the current commercial reagent (BIOREBA). Two state certification programs are now using the new reagent in their testing and monitoring of GLRaV-3 in vineyards and nursery stocks. Colleagues from Australia, France and Israel also ordered the reagents in their testing. To read more detail, please visit Wine Industry Network or download a copy of our news release.
Red Blotch Diseases and Virus Status in CDFA Certified Nursery Blocks
An article by James Stamp and Alan Wei, Wine Business Monthly, August, 2014. This article may be downloaded from any of the sources below.
1. Agri-Analysis
2. Napa Valley Grapegrowers
3. Wine Industry Network
4. Lodi Wine Growers
5. Wine Business Monthly
6. Vineyard Team
NCPN Meeting for Grapes to be Held on January 30 in Davis.
The National Clean Plant Network for Grapes was established in 2008 for the purpose of efficiently producing, maintaining and distributing healthy grapevine plant material to all aspects of the grape industry, including table, wine, juice, raisin and rootstock grape producers and consumers. The NCPN for Grapes supports clean plant centers and provides education and outreach services in support of its mission. For more information, please visit NCPN web site.
Current Wine and Wine Grape Research
This is an exclusive opportunity to hear and discuss the latest research funded by the American Vineyard Foundation. Topics include work on grapevine breeding and evaluation, cultural practices, disease and insect pest control, and enology. The 20-minute report format allows for synopses of many projects in a single day. Each scientist will have 15 minutes to speak and an additional five minutes to answer questions from the audience
When: Monday, February 9, 2015
Where: UC Davis Conference Center
Time: 9:00 am to 5:30 pm
Please visit the UCD Extension web site for Registration and contact information.
The First Public Hearing on Grapevine Certification Program was held on December 18 in Sacramento. Joshua Kress, Program Supervisor at CDFA, presented current requirements of testing, inspection, eligibility and traceability on foundation blocks, Increase blocks and certified nursery plantings.
Current Disease Testing Frequency:
Current Inspection Frequency:
Current Record-keeping/Traceability Requirements
Some of participants comments can be found on Wine Business Monthly web site.
CDFA has set the first public meeting regarding potential changes in the Regulation and Certification Program for Grapevines on December 18, 2014. I urge growers who are concerned to attend. CDFA wants to hear your input to effect the needed changes to protect and insure clean plants for our industry. Please find the attached notice and agenda. Please contact Josh for more details:
Joshua KressProgram SupervisorNursery, Seed, & Cotton ProgramCA Department of Food & Agriculture(916) 654-0435In today's FPS Annual Meeting, Dr. Deborah Golino, director of Foundation Plant Services (FPS) at UC Davis, reported their research survey results of 56 dry leaf samples in the Davis Herbarium from 1937 to 1950. One out of 56 samples was found to be positive for red blotch gene. Further genetic analysis showed 99% homology with red blotch virus genome recently reported by several research groups. The leaf sample was from Early Burgundy collected by Dr. Harold Olmo in Sonoma county in 1940.
Innovative Reagent Detects Broader LR3 Variants
Funded by a USDA Small Business Innovative Research (SBIR) grant, Agri-Analysis has developed a new reagent that can detect broader leafroll 3 variants than the current commercial reagent (BIOREBA). Two state certification programs are using the new reagent in their testing and monitoring of GLRaV-3 in vineyards and nursery stocks. To read more detail, please visit Wine Industry Network or download a copy of our news release.
Visit Agri-Analysis at the North Coast Wine Industry Expo
The Wine Industry Network has graciously provided complimentary Trade Show Floor Only tickets to clients and associates of Agri-Analysis. I would like to cordially invite you to please visit the WIN North Coast Expo web site to review the program and to register for you and your associates. When you register, please use the discount code AGR441.
When: Thursday, December 4, 2014
Where: Sonoma County Fairgrounds, 1350 Bennett Valley Rd, Santa Rosa, CA 95404
Time: 9:00 am to 4:00 pm
Agri-Analysis booth number is #441. I look forward to seeing you at the conference. Thank you!
Red Blotch Diseases and Virus Status in CDFA Certified Nursery Blocks
An article by James Stamp and Alan Wei, Wine Business Monthly, August, 2014. This article may be downloaded from any of the sources below.
1. Agri-Analysis
2. Napa Valley Grapegrowers
3. Wine Industry Network
4. Lodi Wine Growers
5. Wine Business Monthly
6. Vineyard Team
Using Soil Moisture Sensors for Vineyard Irrigation Management
An article by Fritz Westover and Kris Beal provides a practical guide for installing and interpreting information from soil moisture monitoring technologies in vineyards. This is a Vineyard Team Publication that can be downloaded.
Tulare Grape Roundtable
Come join your fellow grape PCAs and faculty researchers in a free-wheeling discussion of grape pest management issues in the San Joaquin Valley When: Monday December 1, 2014 from 10:00 AM to 2:00 PM PST Where: Tulare Ag Building, 4437 South Laspina, Tulare, CA Please contact: Bill Rothfuss at director@aaie.net
Third Annual Vineyards and Wineries Series
CURRENT ISSUES IN VINEYARD HEALTH
When: Tuesday, Dec 2, 2014
Where: UC Davis Conference Center
Time: 9:00 am to 4:00 pm
Please visit the UCD Extension for Registration and contact information.
BROCHURES AND LITERATURE ON GRAPEVINE RED BLOTCH VIRUS.
Agri-Analysis Brochure and other literature is online
UCDavis/USDA-ARS Brochure is available online
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. With publisher's permission.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact S cott at AVF, Michael Sipiora or Bob Steinhauer.
|
|
Title: "Virus Status of CDFA-Certified Grapevine Nursery Stock: Current Perspectives and Protocol 2010"
Speakers: Alan Wei, Ph.D. Agri-Analysis and James Stamp, Ph.D. Stamp Associates Professional Viticulture Services
Time and Place: 12:30 pm Thursday, November 13, Napa Exposition Fairgrounds, 575 Third Street, Napa, CA 94558. Napa Valley Grape Growers Rootstock Conference.
Synopsis: Grapevine red blotch virus (GRBaV) and leafroll associated virus 3 (GLaV-3) are the most economically important viruses in grapevine production and are designated as exclusion pests in most grapevine certification programs. Growers, however, are often frustrated to find GRBaV and GLaV-3 in their vineyards and in certified nursery stock. During recent months there has been intense discussion among key California stakeholders as to why these viruses are found in certified materials and how to rectify this situation. Last week, CDFA announced the review of grapevine certification program. In this presentation, we would like share our views and experience on this important issue facing our industry. We believe these are technical challenges that require science based solutions. In addition to the development of better diagnostic tools for use by certification programs, nurseries and growers, the availability of a "new generation" of clean planting materials is critical. At many nurseries starting 2016 and beyond, Protocol 2010-derived materials are now available - especially for rootstock varieties. These materials have all passed through a tissue culture disease elimination program and are "theoretically" free of all known grapevine viruses and vitiviruses and Xylella fastidiosa (causative agent of Pierce's Disease) and Agrobacterium vitis - the crown gall bacterium. We will discuss the pathogen status of CDFA certified materials, new developments in diagnostics, and the importance of correct application of nursery methods to Protocol 2010 nursery stock.
Since fall of 2013, Agri-Analysis has identified a number of GLRaV-3 positive samples from vineyards in Napa and Sonoma that were tested negative using the current commercial reagent (BIOREBA). Figure 1 is a set of data comparing the testing results of ten samples. One sample was tested positive for GLRaV-3 by both methods (left). Seven samples were tested positive for GLRaV-3 only when using Agri-Analysis reagent but not by Bioreba. These seven samples were first tested in December 2013 using cane samples (AA1, green) and re-tested in spring of 2014 using petiole samples (AA2, light green).
Figure 1. The comparison of testing results of ten samples for GLRaV-3 by Bioreba and Agri-Analysis reagents. The majority of GLRaV-3 positive samples were tested positive by both methods. One such sample is shown as "positive" on the left. Seven field samples were tested negative for GLRaV-3 when using the BIOREBA reagent (blue), but consistently tested positive by the new detection reagent developed by Agri-Analysis. AA1 represents the result of testing cane materials in fall of 2013 (green). AA2 represents the result of testing petioles from the same plants in spring of 2014 (light green). Two negative control samples were tested negative by both methods (right). These results were presented at the national meeting of American Phytopathological Society held in August 9-13, 2014 in Minneapolis, MN. To read more see previous update below.
"Red Blotch Diseases and Virus Status in CDFA Certified Nursery Blocks" - An Article by James Stamp and Alan Wei, Wine Business Monthly, August, 2014
Synopsis. THE DISCOVERY OF GRAPEVINE Red Blotch-associated Virus (GRBaV, Red Blotch) in 2012 focused the industry on Red Blotch disease—an unknown condition with recognizable symptoms that growers had been aware of for some time. GRBaV has been found in new planting materials as well as in established vineyards in California and several other winegrowing states in the U.S. During the past 24 months, in an effort to curb disease spread, key stakeholders from the “farm-to-table” supply chain have invested significant time and money to better understand GRBaV. Universities, nurseries, growers, professional associations, industry leaders and testing laboratories have played a critical role in addressing this emerging challenge to the wine industry. Read the full article (pdf) by James A. Stamp, Ph.D., Alan Wei, Ph.D. as featured in Wine Business Monthly.
Agri-Analysis is a proud sponsor of the 2014 Rootstock conference designed by Napa Valley Grapegrowers for grapegrowers, vineyard and winery owners, and winemakers. The conference provides access to high-level, provocative seminars and industry experts, wine trials and tastings, and an exclusive exhibition featuring over 120 of the industry’s highest quality viticulture and enology companies. For more details, please visit: https://www.napagrowers.org/
When: Thursday, November 13, 2014
Where: Napa Exposition Fairgrounds
575 Third Street
Napa, CA 94558
Time: 9:00 am to 3:00 pm
When: Tuesday, Dec 2, 2014
Where: UC Davis Conference Center
Time: 9:00 am to 4:00 pm
Please visit the UCD Extension for Registration and contact information.
Agri-Analysis Brochure and other literature is online
UCDavis/USDA-ARS Brochure is available online
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. With publisher's permission.
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact Scott at AVF, Michael Sipiora or Bob Steinhauer.
.
Grapevine leafroll associated virus 3 (GLaV-3) is, arguably, the No. 1 most economically important virus in grapevine production and is designated as an exclusion pest in most certification programs. However, growers are often frustrated to find this virus in their vineyards and in certified nursery stocks. Since GLRaV-3 is known to be genetically highly variable, we suspect that certain strains may have escaped detection during certification. “Such genetic variability has significant implication in the detection of GLRaV-3 by molecular means and serological assays,” said Dr. Tefera Mekuria, plant virologist at Agri-Analysis. Advances in new testing methods are needed to help address this important issue. Funded by a USDA Small Business Innovative Research (SBIR) Grant, Agri-Analysis has recently developed a new ELISA-based reagent that provides broader coverage of GLRa-V3 variants than the commercial reagent currently in use by most State certification programs. Since fall of 2013, Agri-Analysis has identified a number of GLRaV-3 positive samples from vineyards in Napa and Sonoma that were tested negative using the current commercial reagent (BIOREBA). Figure 1 is a set of data comparing the testing results of ten samples. One sample was tested positive for GLRaV-3 by both methods (left). Seven samples were first tested in December 2013 using cane samples (AA1, green) and recently re-tested in spring of 2014 using petiole samples (AA2, light green). These seven samples were tested positive for GLRaV-3 only by Agri-Analysis reagent but not by the Bioreba reagent. Two control samples were tested negative for GLRaV-3 by both methods (right). The new reagent should have implications in State certification programs because most certification progams use the Bioreba reagent which we believe may have let certain variants of GLRaV-3 escape detection.
Figure 1. The comparson of testing results of ten samples for GLRaV-3 by Bioreba and Agri-Analysis reagents. The majority of GLRaV-3 positive samples were tested positive by both methods. One such sample is labeled as "positive" on the left. Seven field samples were tested negative for GLRaV-3 when using the BIOREBA reagent (blue), but consistently tested positive by the new detection reagent developed by Agri-Analysis. AA1 represents the result of testing cane materials in fall of 2013 (green). AA2 represents the result of testing petioles from the same plants in spring of 2014 (light green). Two negative control samples were tested negative by both methods (right). These results were presented at the national meeting of American Phytopathological Society held in August 9-13, 2014 in Minneapolis, MN.
Could some strains of GLRaV-3 have escaped detection during certification? Dr. Monica Cooper, Napa County farm advisor, UC Cooperative Extension, has been studying the epidemiology of GLRaV-3 for a number of years. When asked for her opinion why the GLRaV-3 virus is found in certified materials, Dr. Cooper commented that “detection reagents could be one explanation. In 2010, I did work with a grower who had LR3(+) vines with clear symptoms that consistently tested negative.” Later, the research laboratory of Dr. Rodrigo Almeida at UC Berkeley was able to isolate a novel variant of LR3 from the samples. “Anything we can do to improve the reagents will certainly make it easier to clean up our vineyards and nursery material over the long-term. I hope that the certification programs in California and other states are keeping updated on their virus testing methods and protocols.” said Dr. Cooper. (Reference: "Red Blotch Disease and the Virus Status of CDFA Certified Nursery Stocks", by Stamp and Wei, Wine Business Monthly, August, 2014 https://www.napagrowers.org/in-the-vineyard/pests-disease/red-blotch/).
BRIEF BACKGROUND ON GRAPEVINE LEAFROLL ASSOCIATED VIRUS 3 (GLRaV-3)
Grapevine leafroll associated virus 3 is a filamentous single stranded RNA virus of 1,800 to 2,000 nm in length and 12 nm in diameter (see Figure 2 below). In an economic impact study by researchers from UCD, the infection rate by GLRaV-3 was estimated to be about 30% in Napa/Sonoma vineyards, and the annual loss to growers was about $88 million (http://vinecon.ucdavis.edu/publications/cwe1306.pdf). In a separate economic impact study by Cornell researchers, the estimated economic impact of grapevine leafroll diseases (GLRD) ranged from approximately $25,000 for a 30% yield reduction and no grape quality penalty to $40,000 per hectare for a 50% yield reduction and a 10% penalty for poor fruit quality in the absence of any control measure. The per hectare impact of GLRD can be substantially reduced to $3,000–$23,000 through roguing if the level of disease prevalence is moderate (1–25%) (http://ajevonline.org/content/63/1/73.full.pdf).
Figure 2. Electron Micrograph of Grapevine Leafroll associated Virus type 3 (1800 to 2000 nm in length and 12 nm in diameter).
Reference: "Grape Leafroll Disease" by Dr. Marc Fuchs. http://www.nysipm.cornell.edu/factsheets/grapes/diseases/grape_leafroll.pdf
For more information, please contact Dr. Alan Wei at apwei@agri-analysis.com.
THE DISCOVERY OF GRAPEVINE Red Blotch-associated Virus (GRBaV, Red Blotch) in 2012 focused the industry on Red Blotch disease—an unknown condition with recognizable symptoms that growers had been aware of for some time. GRBaV has been found in new planting materials as well as in established vineyards in California and several other winegrowing states in the U.S. During the past 18 months, in an effort to curb disease spread, key stakeholders from the “farm-to-table” supply chain have invested significant time and money to better understand GRBaV. Universities, nurseries, growers, professional associations, industry leaders and testing laboratories have played a critical role in addressing this emerging challenge to the wine industry.
Read the full article (pdf) by James A. Stamp, Ph.D., Alan Wei, Ph.D. as featured in Wine Business Monthly.
At Agri-Analysis, our mission is to help growers plant virus-free vineyards and to protect their investment. We strive to accomplish this mission by a) building a company that our employees are proud of; b) providing the most innovative products and services; c) satisfying the articulated and/or unarticulated need of our customers; and d) our strong commitment to community service, education and outreach.
Over 100 Years of Collective Microbial Detection Experience at Your Service
Andy Zinkl Senior Testing Specialist
* UC Davis Graduate
* Joined Agri-Analysis since 1994
* Specializes in Elisa methods
* Responsible for laboratory operations
Dr. Tefera Mekuria Pathologist and Virologist
* Ph.D. University of Oklahoma – Potato Virus
* Postdoctoral Washington State University – Grapevine Viruses and Cherry Viruses
* Over 15 Peer Reviewed Publications
* Invited Reviewer for Several Professional Journals
* Grant reviewer, CDFA Specialty Block Grant
* Specializes in genetic variability of grapevine viruses
Rasha Aldmour Research Assistant
* MS and BS in Agronomy
* Specializes in the Application of molecular and serological methods for the detection of viruses and viroids
* Worked in UC-Davis Foundation Plant Services
* Responsible for sample preparation, PCR and microbiology.
Dr. Xiaodong Wang Molecular Biology Specialist
* Ph.D. University of the Pacific
* Postdoctoral Training in UCSF
* Specializes in Molecular Biology
* Responsible for new methods and new product development, quality control & troubleshooting
Kris Kluepfel Research Assistant
* UC Santa Cruz Biology Major
* Santa Cruz Biotechnology Quality control assistant
* Responsible for sample preparation, PCR and microbiology.
Alessandro Viani Laboratory Aid
* Sac State Biochemistry major
* Assist in various laboratory tasks
Dr. Vlad Omel Research Associate
* Ph.D. in Biophysics from Moscow State University
* Over 30 Years Industrial R&D Experience.
* Specializes in highly sensitive fluorescent assays and methods
Dr. Alan Wei Laboratory Manager
* Ph.D. University of Utah
* 20 Years Industry R&D Experience
* Over 20 United States Patents Related to microbial detection
* On Review Board of the AVF Disease Committee
* On Review Board of NIH Small Business Grants
* PI of Four USDA and NIH Funded Research Projects
* Active supporter of Napa Growers Association and American Vineyard Foundation
A year ago, we did an analysis of the RBaV virus level in different parts of a green bench graft. Since new subscribers have not seen the result and many growers are still very much interested in this question, we decide to re-post the result again here.
We encourage growers to continue to approach the RBaV virus testing from a statistical perspective by selecting the appropriate sample size in order to achieve the growers' testing objectives in a statistically significant manner. In this regard, we would like to draw your attention to the following references.
1. Predicting the rate of spread and sampling accuracy for Red Blotch disease in grape vine blocks. by N. McRoberts, AJ Campbell, R. Gilbertson, Michael Anderson, D. Golino, UC Davis
2. Determining Sample Size, by Glenn Israel, University of Florida Extensio
3. Grapevine Sampling Statistics and Strategies by Agri-Analysis
Sample Description: CS08 scion was bench grafted onto to 110R rootstock by a grapevine nursery in January of 2013. The vine was grown in green house after callus. Samples were submitted to Agri-Analysis for Red Blotch virus testing in late March by a grower.
EXPERIMENTAL METHODS. Four separate preparations were made from four different portions of one "green" benchgraft: 1. new green tissue; 2. scion wood; 3. rootstock closer to the graft union; 4. rootstock further away from the graft union. The samples were analyzed by both conventional PCR and quantitative PCR (qPCR).
--------------------------------------------------
EXPERIMENTAL RESULTS.
Green Tissue had relatively Low level of red blotch virus. The relative viral DNA copy number was determined to be = (290+/-89) by qPCR.
Scion Wood had the highest level of red blotch virus. The relative viral DNA copy number was determined to be = (5,450+/-861) by qPCR.
Rootstock Close to Graft Union had modest level red blotch virus. The relative viral DNA copy number of was determined to be = (1,840+/-914) by qPCR.
Rootstock Further Away from Graft Union: No red blotch virus was detected by conventional PCR or qPCR.
CONCLUSION. The relative virus level in the green growth, the scion, the two rootstock portions #3 and #4 was found to be 1 : 19 : 6 : 0, respectively. In other word, the virus level in the green growth is about 5% of that in the scion wood. This result suggests that the CS08 scion wood was most likely infected before grafting. The virus level in the new green growth was about 5% of that in the scion wood. By comparison, the virus level in the upper portion of rootstock was about 17% of that in the scion wood. We expect the viral copies to increase as the growth continues.
CDFA PD/GWSS Board To Discuss Red Blotch and Vine Mealybugs on April 25.
The CDFA Pierce’s Disease/Glassy-Winged Sharpshooter (PD/GWSS) Board is scheduled to hold "designation discussions" on BROWN MARMORATED STINK BUG, VINE MEALYBUG and RED BLOTCH on April 25. For more details, please visit CDFA web site.
CURRENT ISSUES: AN IN-DEPTH LOOK AT RED LEAF VIRUSES.
When: Friday, May 9, 2014
Where: Freeborn Hall at UC Davis
Time: 9:00am to 3:45pm
Please visit the UCD Viticulture and Enology Web Site for Registration and contact information.
BROCHURES AND LITERATURE ON GRAPEVINE RED BLOTCH VIRUS.
Agri-Analysis Brochure and other literature is online
UCDavis/USDA-ARS Brochure is available online
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. With publisher's permission.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact S cott at AVF, Michael Sipiora or Bob Steinhauer.
Dear Grower,
We are pleased to share some information on the incidence rate of RBaV infected vines based on all samples we tested in the first three months of 2014.
As shown in the graph below, the percent RBaV infected vines is lower in each of the three months of this year than the corresponding period a year ago. This result represents the result of all samples we tested in Q1 of 2014 from various locations and and diverse sources including both nursery materials as well as field cuttings. During this period, vast majority of samples were dormant materials without symptoms that were primarliy destined for new planting for the 2014 or 2015 season.
We applaud your efforts in lowering the incidence rate because this result shows that the community wide efforts in combating this virus are starting to produce benefits. We encourage growers to continue to be vigilant in screening new planting materials for RBaV and LR3 - two of the most economically important grapevine viruses.
Sincerely,
Dr. Alan Wei. Dr. Tefera Mekuria, Plant Pathologist and Virologist
Agri-Analysis LLC
930 Riverside Parkway, Suite #30
West Sacramento, CA 95605
tel: 800.506.9852
fax: 530.757.4655
www.agri-analysis.com
Grapevine & Seed Testing Since
Dear Grower,
As you know, during the past eighteen months, red blotch has been of great concern to growers due to its negative effect on grape and wine quality. Many articles and presentations are available in the open literature. CDFA have held open hearings to decide if to classify it as a pest. As a result, growers have been vigilant in testing for red blotch virus in an effort to screen it out of your new planting materials.
At the same time, I would like to remind everyone that Leafroll 3 virus is still very much prevalent in our vineyards and planting materials. A recent UC Davis study reported 30% vines in the field currently have Leafroll 3 in the Napa-Sonoma region and infected vines on average has a 35% lower in yield. This resulted in an estimated annual loss of $88 million by LR3 alone in Napa and Sonoma wine growing regions (http://vinecon.ucdavis.edu/publications/cwe1306.pdf).
We conduct random surveys of customer samples that were received for red blotch virus testing only. We often found Leafroll 3 in them and informed growers promptly. So, please do not forget to test for Leafroll 3 even though it was in the exclusion program.
Thank you for your attention. It is truly a community wide effort.
Sincerely,
Alan
--
Alan Wei, Ph.D.
Agri-Analysis LLC
930 Riverside Parkway, Suite #30
West Sacramento, CA 95605
tel: 800.506.9852
fax: 530.757.4655
www.agri-analysis.com
Grapevine & Seed Testing Since 1981
Dear Growers,
A recent UC Davis study reported 30% vines in the field currently have Leafroll 3 in the Napa-Sonoma region. Infected vines on average has a 35% lower in yield. The economic loss to growers in this region was estimated at $88 million annually by leafoll 3 alone (see link #1 below). The red blotch virus was newly discovered in 2012. While the discovery of this virus was new, growers have experienced the red blotch disease for many years. RBaV has been reported to cause delayed ripening, decline in sugar, tannin and anthocyanin levels and change in wine flavor. A report presented at the recent Unified Symposium by the winemaker from one of Napa’s famed wineries suggested that instead of returning as much as $90,000 per acre from healthy vines for a $100 per bottle wine, red blotch infected vines may only produce wines sold as bulk returning $10,800 per acre (link #2 below). Since RBaV was NOT part of the CDFA certification program for exclusion, one could suspect that the RBaV infection rate in the field are much higher than that associated with LR3.
Pest and disease control is one of your most important priorities. We believe that effective testing has to be an integral part of any management program, certification program, or regulatory legislation in order to mitigate risks of these viruses. The spring season offers the best opportunity to screen these harmful viruses out of new planting materails and therefore out of our valued vineyards.
I am pleased to let you know that Agri-Analysis has added new skilled personnel to our staff in order to meet your requirement for high throughput screening and fast turn around from sample-to-result. I encourage to take a look at our online brochure (link #3) and to call us to discuss sampling strategies and sample size in order to reach sttastistically significant testing result.
Sincerely,
--
Alan Wei, Ph.D.
Agri-Analysis LLC
930 Riverside Parkway, Suite #30
West Sacramento, CA 95605
tel: 800.506.9852
fax: 530.757.4655
www.agri-analysis.com
Grapevine & Seed Testing Since 1981
Since my communication last fall on sampling statistics, many growers have asked the question of how many samples are sufficient in order to achieve statistically significant testing result?
I took the information from our brochure, and made a table on the right to show the sample size in relation to the total number of plants to be sampled. This table is valid under the assumptions listed.
As you know, in real world, the sample size is dependent on a number of complex factors. This example intends to encourage growers to approach the clean plant testing from a statistical perspective. l invite you to please conatct me and our Grapevine Virologist Dr. Tefera Mekuria to discuss your specific need.
Sincerely,
Alan Wei
Alan Wei, Ph.D.
Laboratory Manager
930 Riverside Parkway, Suite #30
West Sacramento, CA 95605
1.800.506.9852
apwei@agri-analysis.com
www.agri-analysis.com
Download Red Blotch Brochure
Suggested Sample Size in Relation to the Total Number of Plants to be Sampled From.
Assumptions: random and uniform infection at estimated infection rate of 15%. Confidence level is 95% and margin of error is 5%.
Result Interpretation. Based on the table below, if a grower is planning to plant 10,000 new plants, the grower would need to take 193 sample for testing. If all of 193 samples test negative (0%) for grapevine red blotch virus, the infection rate would be estimated to be 0+/-5% with 95% confidence.
Total Number of Plants |
Sample Size |
100 |
67 |
200 |
100 |
500 |
141 |
1,000 |
164 |
2,000 |
179 |
3,000 |
184 |
4,000 |
187 |
5,000 |
189 |
7,000 |
191 |
8,000 |
192 |
10,000 |
193 |
15,000 |
194 |
20,000 |
195 |
25,000 |
195 |
BROCHURES AND LITERATURE ON GRAPEVINE RED BLOTCH VIRUS.
Agri-Analysis Brochure is available online:
http://www.agri-analysis.com/UserFiles/Form/redblotch_v2.pdf
UCDavis/USDA-ARS Brochure is available online: http://ucanr.edu/sites/viticulture-fresno/files/157139.pdf
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. Publisher's permission was obtained for the unrestricted distribution of this article.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact Scott at AVF, Michael Sipiora or Bob Steinhauer.
As you gear up for the new planting season, Agri-Analysis is prepared to support you with innovative testing technologies and services to help screen larger number of new planting materials at lower cost.
Since 2011, Agri-analysis has been a recipient of the prestigious Small Business Innovation Research (SBIR) grant from USDA (Phase I). The SBIR grant is highly competitive with an average success rate of 10%. Agri-analysis was truly humbled and honored to be selected among many national peers.
One objective of this research to develop new reagents and methods for faster, more reliable and cost effective screening of grapevine viruses. I am pleased to let you know that, while much work remains to be done, we have made important progress that allows us to conduct fast and high throughput screening of red blotch virus and leafroll 3 virus in grapevines which are the two most damaging viral pests to wine grape production. We are in process to submit a Phase II SBIR application to expand the method to other grapevine pathogens.
l invite you to please conatct me to discuss how these latest research ad technologies could be applied to your specific need.
Thank you!
Sincerely,
Alan Wei
Alan Wei, Ph.D.
Laboratory Manager
930 Riverside Parkway, Suite #30
West Sacramento, CA 95605
1.800.506.9852
apwei@agri-analysis.com
www.agri-analysis.com
Download Red Blotch Brochure
BROCHURES AND LITERATURE ON GRAPEVINE RED BLOTCH VIRUS
Agri-Analysis Brochure is available online:
http://www.agri-analysis.com/UserFiles/Form/redblotch_v2.pdf
UCDavis/USDA-ARS Brochure is available online: http://ucanr.edu/sites/viticulture-fresno/files/157139.pdf
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. Publisher's permission was obtained for the unrestricted distribution of this article.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact Scott at AVF, Michael Sipiora or Bob Steinhauer.
One of the most common questions from growers when conducting virus testing is how to take samples so that the testing result is representative of the actual condition in the vineyard or in the new planting materials. This question becomes much more profound during winter and spring season when there are no symptoms to watch for.
As important as it is, this topic has received relatively little attention by the grapevine research community. As a result, publications on grapevine sampling statistics are scarce.
Historically, the seed health community has been very active in the studies of sampling statistics. Lettuce mosaic virus testing has been a significant portion of Agri-Analysis' services. We conduct seed health statistics routinely in order to meet the CA seed law standard of zero in 30,000 lettuce seeds.
Here I would like to share our experience in applying fundamental statistical concepts to assist clients in their selection of grapevine samples for virus testing. The objective is to assist growers obtain statistically significant results with minimal number of samples therefore maximizing the return of their investment on testing services.
I am happy to say that statistically significant results are achievable with relatively small number of samples under the assumption of random and homogenous distribution of an infection. This is indeed good news to growers.
Real-world sampling of vineyard and nursery materials is often more complex. Please feel to call me to discuss your specific testing objectives and sampling strategy. I will be making a presentation on this subject on November 14 at the Napa Growers Association meeting.
I welcome and appreciate your comments and suggestions.
Thank you!
Sincerely,
Alan Wei
Alan Wei, Ph.D.
Laboratory Manager
930 Riverside Parkway, Suite #30
West Sacramento, CA 95605
1.800.506.9852
apwei@agri-analysis.com
www.agri-analysis.com
Download Red Blotch Brochure
Fundamental Factors Affecting Sample Size
1. Statistical Level of Confidence. The confidence level is the amount of certainty in estimating the true answer based on the testing results of selected samples. The true answer is the percentage you would get if you exhaustively tested every vine. 95% confidence level is commonly accepted in most agriculture applications. Higher confidence level requires a larger sample size.
2. Margin of Error. The margin of error is the amount of error in estimating the true answer based on the testing results of selected samples. Lower margin of error requires a larger sample size. Typical margin of error is 5%.
3. Estimated Infection Rate. If the sample is skewed highly one way (high positive or negative rate), the population probably is, too. Higher skew level requires a smaller sample size than non-skewed samples (50:50).
Below is a simulated graph to show the dependence of sample size (Y axis) on the infection rate (X axis) for a population size of 20,000 at 95% confidence level and 5% to 10% margin of error.
In this example, the grower would randomly select 200 samples from a total of 20,000 vines (1%). At 95% statistical level of confidence, if the true infection rate is 15% or less, the estimated infection rate would have a margin of error of 5% or less. If the true infection rate is between 15% to 50%, the estimated infection would have a margin of error of between 5% to 7%.
Since most grapevine infections are low level (~15%), this result indicates that statistically significant testing result is achievable with relatively small number of samples.
Dependence of Sample Size on Population Size
Statisticians know statistical theory for why small sample sizes are adequate. The analogy is the chef and his soup: every chef knows that it only takes a single sip from a well-stirred soup to determine its taste. Below is a simulated graph to show the dependence of sample size (Y axis) on the population size (X axis) ranging from 500 to 500,000 at 95% confidence level and 5% margin of error.
The sample size does not change significantly for populations larger than 5,000. This result is very good news for growers who have to screen a large number of vines.
Practical Considerations
The above discussions were based on the assumption that the infection is homogeneously and randomly distributed. Practical situations are often much more complex. Nevertheless, tools such as these can help guide growers through the initial screening process based upon which improvements could be made as needed. In this regards, we have learned valuable experience in advising clients as well as learning from them.
Besides random sampling, other sampling methods would include:
a). Symptom based sampling which is commonly used in the fall; b). Composite sampling where samples from multiple vines are combined and tested;
c). Progressive sampling where samples from a small population are tested first before a large population pool is sampled.
d). Stratified sampling where sub-samples are taken from each grape variety.
e). Investigative sampling where clients were trying to identify the source of infection (e.g. scion or rootstock).
BROCHURES AND LITERATURE ON GRAPEVINE RED BLOTCH VIRUS.
Agri-Analysis Brochure is available online:
http://www.agri-analysis.com/UserFiles/Form/redblotch_v2.pdf
UCDavis/USDA-ARS Brochure is available online: http://ucanr.edu/sites/viticulture-fresno/files/157139.pdf
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. Publisher's permission was obtained for the unrestricted distribution of this article.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact Scott at AVF, Michael Sipiora or Bob Steinhauer.
It is with great pleasure that I welcome Dr. Tefera Mekuria to join Agri-Analysis as a senior virologist and plant pathologist. Dr. Mekuria is a recognized expert in grapevine virus research. He has published widely in high impact journals such as Phytopathology and Molecular Plant Microbe Interactions, Archives of Virology and Pant Diseases. Prior to joining Agri-Analysis, Dr. Mekuria was a research associate for six years at Washington State University with extensive experience in different grapevine and tree fruit viruses and virus like agents. Tefera earned his Ph.D. in Plant Pathology from Oklahoma State University.
Dr. Mekuria's responsibilities at Agri-Analysis will include the following:
A. Red blotch virus research;
B. Leafroll virus research;
C. Testing Services and Client outreach.
During the next a few weeks, I will be contacting many of you to arrange for Dr. Mekuria to visit your vineyards. He will also be making a presentation at the Napa Valley Growers' Grape+Wine Expo on November 14, 2013 and also participate in the North Coast Wine Industry Expo on December 5th, 2013.
Current Issues in Vineyard Health on November 22.
This One-day UC Extension Class is tought by Dr. Deborah Golino and guest instructors to provide the latest management information on current topics, including: a) Breeding grapevines for Pierce's Disease resistance; b) Controlling grape fungal disease such as powdery mildew and Botrytis bunch rot diseases; 3) The grape growers' role in managing exotic pests and diseases; 4) Mealybugs and grapevine leafroll viruses
America Vineyard Foundation Funding Decision Announced.
The 2013-2014 funding decisions for the American Vineyard Foundation have been finalized and posted on the UGMVE website. Funded projects cover wide range of research areas vital to the wine grape industry including two projects related to red blotch virus research led by researchers at UC Davis and Cornell.
BROCHURES AND LITERATURE ON GRAPEVINE RED BLOTCH VIRUS.
Agri-Analysis Brochure is available online:
http://www.agri-analysis.com/UserFiles/Form/redblotch_v2.pdf
UCDavis/USDA-ARS Brochure is available online: http://ucanr.edu/sites/viticulture-fresno/files/157139.pdf
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. Publisher's permission was obtained for the unrestricted distribution of this article.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact Scott at AVF, Michael Sipiora or Bob Steinhauer.
.
During the recent ASEV national conference held in Monterey, CA, Dr. Marc Fuchs, Cornell University, reported their most recent work to prove Koch's postulates for RBaV. They first isolated the viral DNA from infected vines, transformed it into a "carrier" - agrobacterium. Healthy grapevines were soaked in a solution of the carrier agrobacterium, and 4 to 6 months after infection, the grapevines started to show red leaf symptoms. "Based on these and other results and studies, I am confident that RBaV is the causal agent of red blotch disease observed in California and other grape growing regions", said Dr Fuchs.
Collaborative Vineyards Sought for Vector research
Dr. Mysore Sudarshana, Research Biologist, USDA-ARS, recently received special USDA funding to conduct research on determining insect vectors capable of transmitting grapevine red blotch-associated virus in California Vineyards. To this end, Dr. Sudarshana is looking for volunteer vineyards to cooperate on his research. He is particularly interested in organic vineyards where red blotch disease is prevalent where he can look for leafhoppers that may be collected and tested for the presence of the virus. Cooperation from growers important in developing guidelines for the management of this newly described disease. please contact Dr. Sudarshana at (530)752-3621 or mrSudarshana@ucdavis.edu.
GRBaV is widely found in grapevine nursery stock and established vineyards. Vines with foliar symptoms were tested positive; vines without foliar symptoms were negative. Infected grape varieties include not only reds such as Merlot, Zinfandel, Mouvedre, Petite Sirah, Cabernet Franc, Cabernet Sauvignon, Malbec, Pinot Noir and Petit Verdot, but also white varieties such as Chardonnay, Sauvignon Blanc and Riesling. Preliminary indications suggest that it could cause potentially serious damages including vine decline, delayed ripening, low yield, and low sugar content.
Learn more about GRBaV from our recommended reading list and contact Alan Wei at 1.800.506.9852 for your testing needs.
"ASEV Red Blotch Session, Thursday, June 27, 2013", Speakers: Marc Fuchs, Deborah Golino, Rhonda J. Smith and Mysore Sudarshana
"The Impact of Grapevine Red Blotch Associated Virus", James Stamp and Alan Wei, Wine Business Monthly, March 2013.
"Association of a DNA virus with Grapevines affected by Red Blotch disease in California". Al Rwahnih M, Dave A, Anderson MM, Rowhani A, Uyemoto JK and Sudarshana M. Phytopathology. May 8 2013.
"A Leafhopper-Transmissible DNA Virus with Novel Evolutionary Lineage in the Family Geminiviridae Implicated in Grapevine Redleaf Disease by Next-Generation Sequencing", S Poojari, OJ Alabi, VY Fofanov and RA Naidu. PLoS ONE 8(6), 2013.
"Complete Genome Sequence of a New Circular DNA Virus from Grapevine", Björn Krenz, Jeremy R. Thompson, Marc Fuchs and Keith L. Perry, J. Virol. 2012, 86(14):7715.
"Grapevine geminivirus isolate 3138-03, complete genome", Rott ME and Belton M. Aug 29, 2012.
"Grapevine geminivirus isolate JRT[456]17NOV10, complete genome", Krenz B, Thompson JR, Fuchs M and Perry KL April 4, 2012.
"Grapevine geminivirus, complete genome", Krenz B, Thompson JR, Fuchs M and Perry KL April 4, 2012.
"Koch's Postulates for Grapevine Red Blotch Associated Virus - A Story of Three Vines", Agri-Analysis LLC, February 2013.
"Grapevine Red Blotch Associated Virus Level in New Green Tissues", Agri-Analysis LLC, May 2013.
"Red Blotch Disease Sparks Collaborative Research Effort with Lead Funding by the American Vineyard Foundation", American Vineyard Foundation, May 23, 2013.
"Grapevine Red Blotch Associated Virus - A Brochure", Agri-Analysis LLC, October 2012.
VIRUS DISTRIBUTION EXPERIMENT #1
Sample Description: CS08 scion was bench grafted onto to 110R rootstock by a grapevine nursery in January of 2013. The vine was grown in green house after callus. Samples were submitted to Agri-Analysis for Red Blotch virus testing in late March by a grower.
EXPERIMENT METHODS. Four separate samples were prepared from four different four portions of one "green" benchgraft: 1. new green tissue; 2. scion wood; 3. rootstock closer to the graft union; 4. rootstock further away from the graft union. Conventional PCR was conducted by Agri-Analysis. Quantitative PCR (qPCR) was independently conducted in the laboratory of Dr. Mysore Sudarshana, USDA/ARS at UCDavis.
(The relative virus level in green, scion, RS3 and RS4 is 1 : 19 : 6 : 0, respectively. In other word, the virus level in green growth is about 5% of that in scion wood.)
--------------------------------------------------
EXPERIMENTAL RESULTS.
Sample #1. Green Tissue: Low level of red blotch virus was observed by conventional PCR. The virus DNA copy number of RBaV was determined to be = (290+/-89) by quantitative PCR (qPCR).
Sample #2. Scion Wood: High level of red blotch virus was observed by conventional PCR. The relative DNA copy number of RBaV was determined to be = (5,450+/-861) by quantitative PCR (qPCR).
Sample #3. Rootstock Close to Graft Union: Modest level of red blotch was observed by conventional PCR. The relative DNA copy number of RBaV was determined to be = (1,840+/-914) by quantitative PCR (qPCR).
Sample #4. Rootstock Further Away from Graft Union: No red blotch virus was detected by conventional PCR. The DNA copy number of RBaV was determined to be = 0 by quantitative PCR (qPCR).
This experiment suggests that the CS08 scion wood was most likely infected before grafting. The virus level in the new green growth was about 5% of that in the scion wood. By comparison, the virus level in the upper portion of rootstock was about 17% of that in the scion wood. We would expect these numbers to increase as growth continues.
VIRUS DISTRIBUTION EXPERIMENT #2
In the second experiment, we tested two samples of chardonnay on 101-14 with green growth of approximately three weeks. For each sample, we prepared the green growth and cane wood separately. Conventional PCR was conducted by Agri-Analysis and quantitative PCR (qPCR) was conducted independently by the laboratory of Dr. Mysore Sudarshana, USDA/ARS at UCDavis. Results are as follows:
----------------------------------------------------
Sample #1 Sample #1
Canewood Green Shoots
(CH/101-14) (CH/101-14)
PCR: High Level Modest Level
qPCR: 12,300+/-1185 683+/-135
The Ratio of Virus in Canewood to Green Shoot was 18:1 (i.e. the green shoot had about 5% virus relative to cane wood)
----------------------------------------------------
Sample #2 Sample #2
Canewood Green Shoots
(CH/101-14) (CH/101-14)
PCR: High Level Modest Level
qPCR: 33,700+/-5350 954+/-283
The Ratio of Virus in Canewood to Green Shoot was 35:1 (i.e. The green shoot had about 3% virus relative to cane wood.)
----------------------------------------------------
CDFA PD/GWSS Board Discussed Red Blotch on April 29.
The California Department of Food and Agriculture’s (CDFA) Pierce’s Disease/Glassy-Winged Sharpshooter (PD/GWSS) Board held a lengthy discussion at its April 29 meeting regarding the designation of red blotch disease as a new disease for the Board to target for research and funding, but decided to defer a vote on the designation until its next meeting, scheduled for June 21. For more details, please visit.
America Vineyard Foundation Funding Decision Announced.
The 2013-2014 funding decisions for the American Vineyard Foundation have been finalized and posted on the UGMVE website. Funded projects cover wide range of research areas vital to the wine grape industry including two projects related to red blotch virus research led by researchers at UC Davis and Cornell.
BROCHURES AND LITERATURE ON GRAPEVINE RED BLOTCH VIRUS.
Agri-Analysis Brochure is available online:
http://www.agri-analysis.com/UserFiles/Form/redblotch_v2.pdf
UCDavis/USDA-ARS Brochure is available online: http://ucanr.edu/sites/viticulture-fresno/files/157139.pdf
"The Impact of Grapevine Red Blotch Virus" by Stamp and Wei in March, 2013 WINE BUSINESS MONTHY. Publisher's permission was obtained for the unrestricted distribution of this article.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact Scott at AVF, Michael Sipiora or Bob Steinhauer.
I am pleased to draw your attention to the article in the March issue of WBM entitled "The Impact of Grapevine Red Blotch Virus - Grapevine red blotch-associated virus found in grapevine nursery stock and established vineyards", co-authored by Dr. James Stamp and myself. As a trade magazine article, it is not intended to provide systematic scientific study of this virus. Rather, it provides an up-to-date summary of observations, learnings and opinions through our own work and through our interactions with many of you during the past few months.
On Feb 20, 2013, after a period of careful study and evaluation, UCD-FPS announced its official position on the grapevine red blotch virus which encourages vineyard managers and owners to test this virus in their vineyards and new planting materials.
For many years, growers have observed the impact of this virus, but their experience of RBaV has not been the same: Some growers report low Brix in certain affected varieties or clones but not others; Some growers reported little change in Brix but observed "poor flavor" of fruits from infected vines; Some growers spend 15 to 20% extra management effort and cost in order to keep the infected vines productive, while some growers decide to take the infected plants out; Some growers tolerate certain levels of infection in their selection for new planting materials, while others would have zero tolerance for it.
I would greatly appreciate your crucial review and comments of this article. Please do not hesitate to contact me or Dr. James Stamp if you need any more information.
Thank you!
Sincerely,
Alan Wei
Alan Wei, Ph.D.
Laboratory Manager
930 Riverside Parkway, Suite #30
West Sacramento, CA 95605
1.800.506.9852
apwei@agri-analysis.com
www.agri-analysis.com
Download Red Blotch Brochure
We Help Protect Your Investments.
Highlights from "The Impact of Grapevine Red Blotch Virus" by Stamp and Wei, Wine Business Monthly, March 1, 2013. (for a full copy, please visit WBM or download from Agri-Analysis web site)
March 6: NAPA VALLEY GROWERS ASSOCIATION EVENT ON SUSTAINABLE VINEYARDS PRACTICES.
Presentations include: 1) Vine Mealybug Population by Joel King of Napa County; 2) Vine Mealybug Management by Ashfaq Sial and Brian Hogg of UC Berkeley; 3) Virginia Creeper Leafhopper by Lucia Varela of UC IPM. 4) Next Generation Sequencing and Grapevine Red Blotch-Associated Virus by Maher Rwahnih of UCDavis FPS; 4) Grapevine Leafroll Disease Management by Monica Cooper of UC Extension. Please register here.
March 25: Webinar Hosted by Cornell, UCdavis and NCPN
Cornell University virologist Marc Fuchs, UC Cooperative Extension Advisor Rhonda Smith, and UC Davis Foundation Plant Services director Deborah Golino will describe the virus, its impact on vine health, what informal field observations have told us, and what measures are being taken to test and identify infected vines and planting material. Please register here.
UCDAVIS FPS POSITION ON RED BLOTCH VIRUS.
On Feb 20, 2013, Ucd-fps announced its official position on grapevine red blotch virus which encourages vineyard managers and owners to test this virus in their vineyards. For more details, please visit here and also the FPS Blog.
BROCHURES ON GRAPEVINE RED BLOTCH VIRUS.
Agri-Analysis Brochure is available online.
UCDavis/USDA-ARS Brochure is available online.
Wine Industry Network Blog.
Wine Business Monthly Blog.
SUPPORT RED BLOTCH DISEASE RESEARCH
Agri-Analysis is a proud contributor to the American Vineyard Foundation and to UC Davis for grapevine red blotch research. Please contact Scott at AVF, Michael Sipiora or Bob Steinhauer.
I would like to share three photos taken by an observant customer in early December. The cultivar is cabernet sauvignon clone 7 on rootstock O3916. The first vine looks normal for the season. The second vine has speckled red leaves. The third vine has completely red leaves.
We conducted 19-virus extensive panel analysis of these three samples. For red blotch associated virus (RBaV) analysis by conventional PCR, we found one sample gave no band, one gave a band of weak-to-intermediate intensity and one gave a strong-intense band on the DNA gel. The DNA copy numbers of RBaV were determined independently by Dr. Sudarshana's lab at UCDavis/ARS .
The severity of symptoms does seem to correlate with the viral DNA copy numbers. If you see similar vines in the field, please let me know, as this is a critical piece of information to satisfy the modern version of Koch's postulates - to correlate the viral gene copy number with the disease severity of the host.
Sample #1. Normal and green foliage: RSP and RSP-Sy were positive. RBaV and sixteen viruses were negative. No PCR gel band of RBaV was observed by conventional PCR; the relative DNA copy number of RBaV was zero by quantitative PCR (qPCR).
Sample #2. Speckled red foliage: RBaV was positive. All other eighteen viruses were negative. A weak-to-intermediate PCR band of RBaV was observed by conventional PCR; the relative DNA copy number of RBaV = 200+/- by qPCR.
Sample #3. Complete red foliage: RBaV was strongly positive. All other eighteen viruses were negative. A strong PCR band of RBaV was observed by conventional PCR; the relative DNA copy number of RBaV = 80,000+/- by qPCR.
WINEGRAPE RESEARCH WORKSHOP 2/21.
A full day of presentations by researchers describing their current projects will be hosted by FPS and Dr. Debora Golino on Feb, 21. Please register here. For FBS Annual meeting on Feb 20, please register here.
Please do not hesitate to contact me if you need any more information.
During the 17th scientific meeting of the International Council for the Study of Virus and Virus-Like Diseases of the Grapevine (ICVG) held at UC Davis, October 7-14, 2012, scientists from Cornell and UC Davis reported the discovery of a new grapevine virus. Dr. Keith Perry, Department of Plant Pathology of Cornell Univeristy, reported a new circular DNA virus from grapevine which is named "Grapevine cabernet franc-associated virus (GCFaV)". Dr. Mysore Sudarshana, USDA-ARS, Department of Plant Pathology of UC Davis reported a circular DNA virus in grapevines affected by red blotch diseases. They named this virus "Grapevine red blotch-associated virus (GRBaV)". It is believed that GCFaV and GRBaV are the same virus that belongs to the family of Geminiviridae. Noteworthy is the fact that it is a circular DNA virus composed of 3,206 nucleotides as opposed to linear RNA viruses which make up the majority of the grapevine virome.